ID: 1008290090

View in Genome Browser
Species Human (GRCh38)
Location 6:49704972-49704994
Sequence CAGTGTAAGCTGTGGTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 0, 3: 37, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008290087_1008290090 30 Left 1008290087 6:49704919-49704941 CCTTGGAGTAGAGTTGTTCTGAG 0: 1
1: 0
2: 3
3: 55
4: 1721
Right 1008290090 6:49704972-49704994 CAGTGTAAGCTGTGGTAGTATGG 0: 1
1: 1
2: 0
3: 37
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008290090 Original CRISPR CAGTGTAAGCTGTGGTAGTA TGG Intronic
900698991 1:4032308-4032330 CAGTGTGGGTTGTGGTGGTAGGG + Intergenic
906910565 1:49944186-49944208 GAGCATCAGCTGTGGTAGTATGG - Intronic
907398212 1:54207171-54207193 CAGTGTAATCTGTGCTATGATGG - Intronic
908981778 1:69967436-69967458 AAGTATCAGCTGTGGCAGTATGG - Intronic
909209792 1:72808599-72808621 CATTTTAACCTGTGGTGGTATGG + Intergenic
911678872 1:100691550-100691572 GAGCATCAGCTGTGGTAGTATGG + Intergenic
912616112 1:111101919-111101941 CAGCATCAGCTGTGGTAGTATGG + Intergenic
912647065 1:111403294-111403316 CAATATAACCTGTGGTATTATGG - Intergenic
913418192 1:118635685-118635707 GAGCATCAGCTGTGGTAGTATGG + Intergenic
916712116 1:167420726-167420748 GAGTGTAGGGTGTGGTAGCAAGG + Exonic
918422965 1:184382740-184382762 CAGTGTTAGCTGTGATTGCATGG + Intergenic
919548222 1:198949864-198949886 CAGTATAAGCTTTGGCATTAGGG + Intergenic
919971402 1:202581959-202581981 GGGTGAAAGCTGTGGTAGCAGGG - Exonic
920366499 1:205450725-205450747 CCAAGTAAGCTGTGGAAGTAGGG + Intronic
920858947 1:209689236-209689258 TAGTGTAAGCTGGGGTAGGGTGG - Intronic
922396029 1:225202197-225202219 AAGCATCAGCTGTGGTAGTATGG + Intronic
922657944 1:227402137-227402159 GAGCGTCAGCTGTGGTAGTATGG - Intergenic
923610646 1:235489799-235489821 CAGTGTAAAGTGTGGTGGCAAGG - Intronic
1063553201 10:7052655-7052677 CAGTTTCAGATGTGGTATTAAGG - Intergenic
1065470925 10:26081059-26081081 AAGTATCAGCTGTGGTAGTATGG + Intronic
1066145473 10:32553827-32553849 GAGCATCAGCTGTGGTAGTATGG + Intronic
1067196523 10:44124299-44124321 AAGTGTGGGCTGTGGTAGTGTGG - Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1069071969 10:63998547-63998569 CAGGGGAAGCTGTTGTAGTATGG - Intergenic
1069325313 10:67225358-67225380 GAGCATCAGCTGTGGTAGTATGG - Intronic
1070327724 10:75399380-75399402 CAGTGGTAGCTGAGGCAGTAAGG + Exonic
1071103908 10:82071824-82071846 GAATGTGAGCTGTTGTAGTAAGG + Intronic
1071910675 10:90229486-90229508 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1072928009 10:99633786-99633808 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1074068575 10:110042325-110042347 CAGCGAAGGCAGTGGTAGTAAGG + Intronic
1075943461 10:126411044-126411066 AAGTGGAAGCTGGGGAAGTAGGG - Intergenic
1075946838 10:126440525-126440547 TAGCATCAGCTGTGGTAGTATGG - Intronic
1079464149 11:20713126-20713148 GAGCATCAGCTGTGGTAGTAGGG + Intronic
1079791687 11:24747553-24747575 GAGCATCAGCTGTGGTAGTATGG + Intronic
1082200049 11:49355741-49355763 TAGTGTGAGCTGTAGTAGTTTGG + Intergenic
1083222313 11:61260623-61260645 CAGGGTAAGCTGTGGTGTTCAGG - Intronic
1086300640 11:85423434-85423456 GAGTATCAGCTGTGGTAATATGG + Intronic
1086655622 11:89350467-89350489 TAGTGTGAGCTGTGGTAGTTTGG - Intronic
1087619515 11:100525807-100525829 CAGCATCAACTGTGGTAGTATGG - Intergenic
1090304719 11:125681391-125681413 CAGTGTCAACTGTGGCAGGAAGG - Intergenic
1090753064 11:129764131-129764153 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1090894986 11:130964216-130964238 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1092272456 12:7034061-7034083 CAGTGTCAGCTATGTTCGTAGGG + Intronic
1094447321 12:30546030-30546052 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1094722237 12:33076692-33076714 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1095115318 12:38345046-38345068 AAGCATTAGCTGTGGTAGTATGG - Intergenic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1095932109 12:47637326-47637348 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1096973802 12:55686986-55687008 CAGAGGAAGGTGGGGTAGTAGGG - Intronic
1099187704 12:79533913-79533935 CATTGGAAGCTGCGGTAGTAGGG + Intergenic
1099477130 12:83121659-83121681 GAGCATAAGCTGTGGTAGTATGG + Intronic
1099687412 12:85907922-85907944 CAGCATCAGCTATGGTAGTATGG + Intergenic
1099710972 12:86223807-86223829 CAGTGCAAGCTATGGTAGTCTGG - Intronic
1100203566 12:92325256-92325278 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1101635234 12:106535308-106535330 GAGAATCAGCTGTGGTAGTATGG + Intronic
1104626996 12:130365230-130365252 CACTGTGAACTGTGGCAGTAGGG + Intronic
1106210921 13:27644480-27644502 CTGAGGAAGCTGTGCTAGTATGG + Intronic
1106681182 13:32009626-32009648 CAGTGCAGGCTGTGGAAGTTGGG + Intergenic
1106964488 13:35045044-35045066 CTGGGTAAGCTGTGGTCGGAGGG + Exonic
1107755970 13:43622762-43622784 GAGCGTCAGCTGTGGTAGTATGG + Intronic
1108469757 13:50756221-50756243 GAGCATCAGCTGTGGTAGTATGG + Intronic
1108817132 13:54305539-54305561 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1109508379 13:63336757-63336779 GAGTATCAGCTGTGGTATTATGG + Intergenic
1110561899 13:76918239-76918261 CAGCATCAGCTGTGGTATTACGG - Intergenic
1110748121 13:79079719-79079741 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1111748196 13:92296271-92296293 GAGCATCAGCTGTGGTAGTATGG + Intronic
1111878346 13:93923733-93923755 CAGTGGCAGCTGTGCTAGTCTGG + Intronic
1112087031 13:96042008-96042030 GAGCATCAGCTGTGGTAGTATGG - Intronic
1115299283 14:31865781-31865803 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1115680352 14:35730870-35730892 GAGCATCAGCTGTGGTAGTATGG - Intronic
1115958558 14:38809237-38809259 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1115969843 14:38932763-38932785 TAGCATCAGCTGTGGTAGTATGG - Intergenic
1116335576 14:43651916-43651938 GAGTATCAGCTGTGGTAGTATGG - Intergenic
1116346746 14:43803428-43803450 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1118165634 14:63332758-63332780 GAGTATCAGCTGTGGTAGTATGG - Intergenic
1118532082 14:66718011-66718033 GAGTATCAGCTGTGGTAGTATGG + Intronic
1120329080 14:83065523-83065545 CAGTGCAAGCTTTTGTAGAATGG - Intergenic
1120489635 14:85161162-85161184 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1121516573 14:94556238-94556260 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125439276 15:39684636-39684658 CAGTGTAGGCTGGGGTATTTAGG - Intronic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1137743385 16:50802637-50802659 CTGTGGAAGCTGTGGTAGAATGG - Intergenic
1141227173 16:82129019-82129041 CAGAGAAAGCTGGGGTATTAAGG + Intergenic
1145216276 17:21054881-21054903 CAGTTCAAGCTGTGGTCCTAGGG - Intergenic
1156944698 18:42814703-42814725 AAGCATCAGCTGTGGTAGTATGG - Intronic
1158829796 18:61264300-61264322 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1159097669 18:63922663-63922685 CAGTCTAAGCTGGGGAAGCAAGG - Intronic
1163886624 19:19971207-19971229 CAGCATCAGCTGTGGTAATATGG + Intergenic
1166604221 19:44126545-44126567 GAGCATCAGCTGTGGTAGTATGG + Intronic
1167879504 19:52444506-52444528 GAGCATCAGCTGTGGTAGTATGG + Intronic
925343348 2:3151643-3151665 GAGCATCAGCTGTGGTAGTATGG - Intergenic
926915969 2:17892928-17892950 CACTTTCAGCTGTGCTAGTATGG + Intronic
928778636 2:34794151-34794173 CTGTGTAAGCTCTGGAAGAAAGG - Intergenic
932270407 2:70403933-70403955 GAGTATCAGCTGTGGTAGTATGG - Intergenic
932384864 2:71323178-71323200 GAGCATCAGCTGTGGTAGTATGG + Intronic
933187313 2:79292233-79292255 CAGTGTTGGCTGTGGCAGTGAGG + Intronic
936554947 2:113488000-113488022 GAGTGTCAGTTGTGGTAGTATGG - Intronic
937521825 2:122721128-122721150 GAGCATCAGCTGTGGTAGTATGG - Intergenic
937723023 2:125126055-125126077 AAGCATCAGCTGTGGTAGTATGG + Intergenic
937767592 2:125679997-125680019 CAGCATCAGCTCTGGTAGTATGG + Intergenic
939745031 2:145957806-145957828 GAGTATCAGCTGCGGTAGTATGG + Intergenic
939769594 2:146299016-146299038 AAGCATCAGCTGTGGTAGTATGG - Intergenic
940039939 2:149349488-149349510 CAGTGCAATATGAGGTAGTAAGG + Intronic
941631586 2:167890961-167890983 GAGTATCAGCTGTGGTAGTATGG + Intergenic
944432044 2:199644546-199644568 GAGCATCAGCTGTGGTAGTAAGG + Intergenic
944602152 2:201313697-201313719 CAGCATCAGCTGTGGTAGTATGG - Intronic
945127063 2:206524375-206524397 CAGTGTAAGTTGTGGAAGTCAGG - Intronic
945482547 2:210360674-210360696 GAGCATCAGCTGTGGTAGTATGG + Intergenic
948714013 2:239847264-239847286 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1169401352 20:5283124-5283146 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1170574995 20:17655640-17655662 CAGTGTAAACTGTGGCAGCCAGG - Intronic
1170720982 20:18879138-18879160 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1172436957 20:34935804-34935826 CAGTGGAAGCCCTGGTAGTGTGG - Intronic
1177140551 21:17353252-17353274 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1178059414 21:28835130-28835152 CAGCATTAGCTGTAGTAGTATGG - Intergenic
1180250734 21:46585701-46585723 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1181454372 22:23047975-23047997 CAGCATCAGCTGTGGTAGTATGG - Intergenic
949814295 3:8041278-8041300 GAGCATCAGCTGTGGTAGTATGG - Intergenic
951712417 3:25597702-25597724 GAGTGAAAGCTGTGGTAGAGTGG + Exonic
953723920 3:45381397-45381419 GAGCATCAGCTGTGGTAGTATGG + Intergenic
954668793 3:52276679-52276701 CATTTAAAGGTGTGGTAGTAGGG - Intronic
956950300 3:74274289-74274311 GAGCATCAGCTGTGGTAGTATGG - Intronic
958013842 3:87914829-87914851 GAGCATCAGCTGTGGTAGTATGG - Intergenic
958480752 3:94643259-94643281 GAGCTTCAGCTGTGGTAGTATGG + Intergenic
958505643 3:94973776-94973798 AAGCATCAGCTGTGGTAGTATGG - Intergenic
958969907 3:100600474-100600496 GAGCATAAGCTATGGTAGTATGG + Intergenic
959715703 3:109430960-109430982 GAGCATTAGCTGTGGTAGTATGG + Intergenic
959802491 3:110512189-110512211 GAGCATAAGCTATGGTAGTATGG + Intergenic
959859506 3:111200876-111200898 CTGTGTAAACTGAGGTAGTCCGG + Intronic
959875203 3:111373815-111373837 GAGCATCAGCTGTGGTAGTATGG - Intronic
959997310 3:112693611-112693633 GAGTATCAACTGTGGTAGTATGG - Intergenic
961269030 3:125673717-125673739 CTGTGTAAGCTTTGGTGGTCTGG - Intergenic
962401813 3:135067195-135067217 GAGCATCAGCTGTGGTAGTATGG + Intronic
964601221 3:158503392-158503414 GAGCATCAGCTGTGGTAGTATGG + Intronic
964643861 3:158937119-158937141 CAGCATCAGCTGTGGTAGTATGG - Intergenic
964713760 3:159699558-159699580 CTGTGCAAACTGTGGTTGTAAGG + Intronic
966020386 3:175202624-175202646 GAGCATCAGCTGTGGTAGTATGG + Intronic
968994289 4:3935990-3936012 CTGTGTAAGCTGGGGTGGTGTGG + Intergenic
970549283 4:17163427-17163449 GAGCATCAGCTGTGGTAGTATGG + Intergenic
970996127 4:22269105-22269127 GAGCATCAGCTGTGGTAGTATGG - Intergenic
971603734 4:28630665-28630687 CAGTGAAAACTGTGCTACTAAGG - Intergenic
972048852 4:34702765-34702787 GAGTATCAGCTGTGGTAGTATGG - Intergenic
972189043 4:36568447-36568469 CAGCATCAGCTGTGGTAGTATGG + Intergenic
973580879 4:52342972-52342994 CAGTGTAAGTTGTGAAAGGAAGG - Intergenic
973831528 4:54764664-54764686 GAATATCAGCTGTGGTAGTATGG + Intergenic
975951049 4:79771824-79771846 GAGCCTCAGCTGTGGTAGTATGG - Intergenic
976556231 4:86453749-86453771 GAGCATCAGCTGTGGTAGTATGG - Intronic
977246632 4:94639236-94639258 CAGTGTAAGATGAGGTTGTGGGG + Intronic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
978128035 4:105158617-105158639 CAGTGTAAACTGAGATATTATGG - Intronic
978865461 4:113503929-113503951 CAGTGTAAACTGTAGTGGTGGGG - Intronic
980523558 4:133961047-133961069 GAGCATCAGCTGTGGTAGTAAGG - Intergenic
981346676 4:143684142-143684164 GAGCATCAGCTGTGGTAGTATGG - Intronic
981400945 4:144313409-144313431 GAGCATCAGCTGTGGTAGTATGG + Intergenic
984721727 4:182978594-182978616 GAGCATCAGCTGTGGTAGTATGG - Intergenic
986870266 5:12036951-12036973 GAGCATCAGCTGTGGTAGTATGG - Intergenic
987122310 5:14778687-14778709 AAGTGTAGGCTGCAGTAGTAAGG - Intronic
988232214 5:28494059-28494081 CAGTGTAGGCTTTGGTAGAGAGG + Intergenic
990572816 5:57095571-57095593 GAGCATCAGCTGTGGTAGTATGG - Intergenic
990776188 5:59308766-59308788 GAGCATCAGCTGTGGTAGTATGG + Intronic
991117413 5:62970196-62970218 GAGCATCAGCTGTGGTAGTATGG - Intergenic
991923914 5:71684561-71684583 GAGCATCAGCTGTGGTAGTATGG - Intergenic
992186585 5:74250357-74250379 CAGTGCAAGGTGGGGTTGTAAGG - Intergenic
994051270 5:95365490-95365512 GAGCATCAGCTGTGGTAGTATGG + Intergenic
994222148 5:97208519-97208541 GAGCCTCAGCTGTGGTAGTATGG + Intergenic
994568340 5:101482771-101482793 GAGTATCAGCTGTGGTAGTATGG + Intergenic
995694563 5:114865367-114865389 AAGCATCAGCTGTGGTAGTATGG + Intergenic
996080847 5:119256186-119256208 GAGCATCAGCTGTGGTAGTATGG - Intergenic
996124111 5:119705945-119705967 GAGTATCAGCTGTAGTAGTATGG + Intergenic
996267532 5:121560007-121560029 CAGTGCAATTTGTGGTAGGAAGG - Intergenic
998820250 5:146051466-146051488 AAGTGTTAGCTGTGGAGGTAGGG + Intronic
999677123 5:154015261-154015283 AAGCATCAGCTGTGGTAGTATGG - Intronic
1001733729 5:173981409-173981431 CAGCATCAGCTGTAGTAGTATGG + Intronic
1002386574 5:178871540-178871562 CATTGTAAGCTGCTGTAGGAGGG + Intronic
1004210407 6:13635766-13635788 CACTGAAAGCTGTGATGGTAAGG - Intronic
1007529288 6:42526683-42526705 CAGTGAGAGCTGTGGTAGTTTGG + Intergenic
1007783627 6:44268222-44268244 GAGTGCAAGCTCTGGTAGTGGGG - Intergenic
1007872312 6:45054192-45054214 CCCTGTAAGCTGTAGTAGGAAGG + Intronic
1008256167 6:49302982-49303004 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1008290090 6:49704972-49704994 CAGTGTAAGCTGTGGTAGTATGG + Intronic
1008478481 6:51959327-51959349 CATTTGAAGATGTGGTAGTAGGG + Intronic
1008528582 6:52433682-52433704 TAGCATTAGCTGTGGTAGTATGG + Intronic
1009798550 6:68503080-68503102 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1009968814 6:70604844-70604866 AAGCATCAGCTGTGGTAGTATGG - Intergenic
1010076335 6:71803216-71803238 GAGTATTAGCTGTGGTAGTATGG + Intergenic
1010707730 6:79134877-79134899 GAGGGTCAGCTATGGTAGTATGG + Intergenic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1011893269 6:92193916-92193938 CAGCATCAGCTGTGGTAGTATGG + Intergenic
1012225112 6:96694545-96694567 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1016289980 6:142518434-142518456 CAGCATCAGCTCTGGTAGTATGG + Intergenic
1018009445 6:159655925-159655947 GAGCGTCAGCGGTGGTAGTATGG - Intergenic
1018910177 6:168097236-168097258 CAGTGTGAGCTGTGTTATAATGG - Intergenic
1022894829 7:34739910-34739932 GAGCATCAGCTGTGGTAGTATGG + Intronic
1024037123 7:45516633-45516655 CAGTGTCAGAAGTGGTAGGAAGG + Intergenic
1028017714 7:85736229-85736251 CTGTGTACGCAGTGGTGGTAAGG - Intergenic
1028182924 7:87747488-87747510 GAGCATCAGCTGTGGTAGTATGG + Intronic
1029401161 7:100347373-100347395 CAGTGGAAGCAGTGCTAGGACGG + Intronic
1030390417 7:108920852-108920874 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1030416724 7:109253566-109253588 CAGGGTTAGCTGTTGTATTAGGG + Intergenic
1034334776 7:150314086-150314108 CATGCTAAGCTGTGGTGGTAGGG + Intronic
1034699298 7:153082783-153082805 CAGTGGTAGCTGTGGTAGTTTGG + Intergenic
1035545268 8:476947-476969 CAGTCAAAGCAGTGGTAGGAGGG - Intergenic
1039641499 8:39227815-39227837 GAGCATCAGCTGTGGTAGTATGG - Intronic
1040635636 8:49270297-49270319 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1041364208 8:57083762-57083784 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1041570513 8:59332927-59332949 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1043040824 8:75259816-75259838 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1043816846 8:84812435-84812457 GAGCATCAGCTGTGGTAGTATGG + Intronic
1046074450 8:109299738-109299760 GAGCATCAGCTGTGGTAGTATGG - Intronic
1047706750 8:127506863-127506885 CACTTTAAGCAGTGGGAGTAGGG + Intergenic
1049898059 9:129184-129206 GAGTGTCAGTTGTGGTAGTATGG + Intronic
1049908207 9:238923-238945 GAGTGCAAGCTGTGATAGGATGG - Intronic
1050394617 9:5182124-5182146 CAGTGTTATCTGTAGTGGTAGGG + Intronic
1052537172 9:29761770-29761792 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1053500938 9:38591066-38591088 CATTGGAGGCTGTGGTAGGAGGG - Intergenic
1053741137 9:41139482-41139504 GAGTGTCAGTTGTGGTAGTATGG + Intronic
1054346347 9:63968971-63968993 GAGTGTCAGTTGTGGTAGTATGG + Intergenic
1054444123 9:65295621-65295643 GAGTGTCAGTTGTGGTAGTATGG + Intergenic
1054486149 9:65725884-65725906 GAGTGTCAGTTGTGGTAGTATGG - Intronic
1054687212 9:68291815-68291837 GAGTGTCAGTTGTGGTAGTATGG - Intronic
1055500931 9:76901798-76901820 CAGTGACAGCTGTGGAAGAAGGG - Intronic
1056684284 9:88746843-88746865 CAGCATTAGCTGTGGTAGAAGGG - Intergenic
1057680348 9:97175575-97175597 CATTGGAGGCTGTGGTAGGAGGG - Intergenic
1058040366 9:100295564-100295586 CAGTGCAGGCTGTGGTTATAGGG + Intronic
1186997409 X:15138732-15138754 CAGTTTAAAATGTGTTAGTAGGG + Intergenic
1188045864 X:25425949-25425971 GAGCATAAGCTGTGGTAGTATGG + Intergenic
1189603216 X:42648966-42648988 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1191080679 X:56506254-56506276 CAGCATCAGCTGTGGTAGTATGG - Intergenic
1191692357 X:63953157-63953179 CAGCATCAGCTATGGTAGTATGG - Intergenic
1192069032 X:67917920-67917942 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1192968150 X:76202184-76202206 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1193389891 X:80913948-80913970 AAGCATCAGCTGTGGTAGTATGG + Intergenic
1194466177 X:94237520-94237542 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1194701459 X:97119558-97119580 GAGCATCAGCTGTGGTAGTATGG + Intronic
1195795491 X:108642373-108642395 AAGCATCAGCTGTGGTAGTATGG - Intronic
1196170926 X:112587742-112587764 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1197463445 X:126771807-126771829 GAGCATCAGCTGTGGTAGTATGG - Intergenic
1197669049 X:129255734-129255756 AAGCATCAGCTGTGGTAGTATGG + Intergenic
1198446317 X:136719497-136719519 CAGTGAAAGCAGTGCTTGTAGGG + Intronic
1199057823 X:143318913-143318935 GAGCATCAGCTGTGGTAGTATGG + Intergenic
1201408483 Y:13673330-13673352 GAGCATCAGCTGTGGTAGTATGG - Intergenic