ID: 1008290977

View in Genome Browser
Species Human (GRCh38)
Location 6:49715770-49715792
Sequence ATGCCCTTCTAGAAAAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008290977_1008290978 2 Left 1008290977 6:49715770-49715792 CCTTTGCTTTTCTAGAAGGGCAT No data
Right 1008290978 6:49715795-49715817 TTTGTTAGTTCCTTTTTCTATGG No data
1008290977_1008290979 7 Left 1008290977 6:49715770-49715792 CCTTTGCTTTTCTAGAAGGGCAT No data
Right 1008290979 6:49715800-49715822 TAGTTCCTTTTTCTATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008290977 Original CRISPR ATGCCCTTCTAGAAAAGCAA AGG (reversed) Intergenic
No off target data available for this crispr