ID: 1008290979

View in Genome Browser
Species Human (GRCh38)
Location 6:49715800-49715822
Sequence TAGTTCCTTTTTCTATGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008290977_1008290979 7 Left 1008290977 6:49715770-49715792 CCTTTGCTTTTCTAGAAGGGCAT No data
Right 1008290979 6:49715800-49715822 TAGTTCCTTTTTCTATGGTTTGG No data
1008290974_1008290979 15 Left 1008290974 6:49715762-49715784 CCAGGAGTCCTTTGCTTTTCTAG No data
Right 1008290979 6:49715800-49715822 TAGTTCCTTTTTCTATGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008290979 Original CRISPR TAGTTCCTTTTTCTATGGTT TGG Intergenic
No off target data available for this crispr