ID: 1008293047

View in Genome Browser
Species Human (GRCh38)
Location 6:49741298-49741320
Sequence CAGGAAAAAACAGCATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008293047_1008293053 9 Left 1008293047 6:49741298-49741320 CCTCCCAATGCTGTTTTTTCCTG 0: 1
1: 0
2: 1
3: 17
4: 316
Right 1008293053 6:49741330-49741352 CTGAGGAGTGGATATAATTCCGG 0: 1
1: 0
2: 1
3: 4
4: 127
1008293047_1008293052 -3 Left 1008293047 6:49741298-49741320 CCTCCCAATGCTGTTTTTTCCTG 0: 1
1: 0
2: 1
3: 17
4: 316
Right 1008293052 6:49741318-49741340 CTGAAATGTAATCTGAGGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 185
1008293047_1008293050 -8 Left 1008293047 6:49741298-49741320 CCTCCCAATGCTGTTTTTTCCTG 0: 1
1: 0
2: 1
3: 17
4: 316
Right 1008293050 6:49741313-49741335 TTTTCCTGAAATGTAATCTGAGG 0: 1
1: 0
2: 4
3: 30
4: 462
1008293047_1008293054 10 Left 1008293047 6:49741298-49741320 CCTCCCAATGCTGTTTTTTCCTG 0: 1
1: 0
2: 1
3: 17
4: 316
Right 1008293054 6:49741331-49741353 TGAGGAGTGGATATAATTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008293047 Original CRISPR CAGGAAAAAACAGCATTGGG AGG (reversed) Intronic
901160752 1:7175096-7175118 CAGGAAAGTACAGGAGTGGGAGG + Intronic
901376658 1:8844508-8844530 CAGGAAGAAAAAGCAGTGGTTGG + Intergenic
902459558 1:16563325-16563347 GATGGACAAACAGCATTGGGAGG - Exonic
902521489 1:17020251-17020273 CAGGAAGAAAGAGCACTGGATGG + Intronic
903160383 1:21483982-21484004 GACGGACAAACAGCATTGGGAGG + Exonic
904369849 1:30041619-30041641 CAGGAAAAAAAAGCCCTGAGTGG - Intergenic
907527838 1:55064010-55064032 CAGGGACAAACATCGTTGGGGGG + Exonic
908516359 1:64896817-64896839 CAGGGAAAACCAGCATGGTGGGG + Intronic
908529560 1:65021379-65021401 AAGGAAAGAACAGAAGTGGGAGG - Intergenic
909509077 1:76430742-76430764 GATGAAAAAACAGCCTTGAGGGG - Intronic
910773491 1:90852120-90852142 CAAGACAAAACATCACTGGGTGG - Intergenic
911447043 1:98009399-98009421 TAGGAAAAGACAGAATTGTGTGG + Intergenic
912268695 1:108187359-108187381 AAAGAAAACACACCATTGGGAGG + Intronic
912913820 1:113791051-113791073 GAGGAACAAACAGAATTGGGAGG + Intronic
913022358 1:114800794-114800816 GAGGAAAAGACAGCATTGAAGGG + Intergenic
913167762 1:116204347-116204369 AAGCAACAAACAGCATTGTGTGG + Intergenic
913606031 1:120466817-120466839 GATGGACAAACAGCATTGGGAGG + Intergenic
913644218 1:120841189-120841211 GATGGACAAACAGCATTGGGAGG + Intronic
914082527 1:144422395-144422417 GATGGACAAACAGCATTGGGAGG - Exonic
914177425 1:145290908-145290930 GATGGACAAACAGCATTGGGAGG - Exonic
914210398 1:145573347-145573369 GATGGACAAACAGCATTGGGAGG - Intergenic
914269322 1:146065700-146065722 GATGGACAAACAGCATTGGGAGG - Exonic
914367775 1:146995171-146995193 GATGGACAAACAGCATTGGGAGG + Exonic
914378994 1:147099608-147099630 GATGAACAAACAGCATTGAGAGG - Intergenic
914485205 1:148103051-148103073 GATGGACAAACAGCATTGGGAGG - Exonic
914532155 1:148532387-148532409 GATGGACAAACAGCATTGGGAGG - Exonic
914585170 1:149055038-149055060 GATGGACAAACAGCATTGGGAGG - Exonic
914636241 1:149555334-149555356 GATGGACAAACAGCATTGGGAGG + Intergenic
915972780 1:160366234-160366256 CAGGAAGAACCAGGATTGGAAGG - Intergenic
916372030 1:164109200-164109222 AAGGAAAAAACAGAAAAGGGAGG - Intergenic
916569166 1:166009751-166009773 CAGGAAGAATCAGCTTTAGGGGG - Intergenic
917024984 1:170631750-170631772 CAAGAAGCAACAGCATTAGGAGG - Intergenic
917215667 1:172675701-172675723 CAGGAAAAGACTGCTTTTGGAGG + Intergenic
917447020 1:175115116-175115138 CAGGGAAATACAGCAGTGGTTGG - Intronic
917725136 1:177820931-177820953 CAGGAAATCACAGCATTGTATGG - Intergenic
918135407 1:181669432-181669454 CAGTCAAATACAGCAGTGGGTGG - Intronic
918416676 1:184316280-184316302 CAGGAAAACTTAGCACTGGGTGG + Intergenic
920528081 1:206683616-206683638 CAGGAAAGGACAGTGTTGGGAGG + Intronic
921454318 1:215349649-215349671 GAGGAAAGACCAGCATTGTGGGG + Intergenic
922372139 1:224922305-224922327 CAGGAAAAAACAAACTTGGAAGG + Intronic
924414839 1:243849400-243849422 CAGGAAAAGACGGCACTGGTGGG - Intronic
1064406872 10:15071805-15071827 CAGGAAAGAACAGCCTTAGATGG - Exonic
1064835891 10:19529532-19529554 CAGAAAAAAACAGGAGGGGGGGG + Intronic
1065143561 10:22743717-22743739 AAGGAAAAAACTGCATGGGTTGG - Intergenic
1065797313 10:29319287-29319309 CAGGGAAAAACACCCTTGGGAGG + Intergenic
1066258094 10:33701416-33701438 AAGGAAATAATAGCATAGGGAGG - Intergenic
1067543401 10:47174368-47174390 AAGGAAAACACAGCACGGGGAGG - Intergenic
1067741458 10:48898706-48898728 CAGGCAAAAGCAGCAGAGGGAGG - Intronic
1067935916 10:50611970-50611992 CAGGAGAAATCAGGACTGGGAGG - Intronic
1068875919 10:61996526-61996548 AAAGAAAAAAAAGGATTGGGTGG + Intronic
1069915943 10:71786879-71786901 CGGGTAAAAGCAGCATTGAGTGG + Intronic
1070305434 10:75236224-75236246 GAGGAGAAAAAAGCATTGGCAGG - Intergenic
1070486652 10:76938306-76938328 CAGGAGAAAGCAGTGTTGGGAGG - Intronic
1070938519 10:80321401-80321423 GAGGAAAAAGCAGGAATGGGTGG + Intergenic
1072390758 10:94983839-94983861 CAGAAAAAAGCAGCACTGTGTGG + Intronic
1073887270 10:108054273-108054295 CAGGAAAAAACACCAGAGTGGGG + Intergenic
1074111402 10:110425258-110425280 CATAAAAAAACAGAATAGGGAGG + Intergenic
1075885885 10:125898625-125898647 GAGGAAAAAACAGGGTTGGAAGG + Intronic
1077788066 11:5406326-5406348 TTGGAAAAAATAGAATTGGGAGG - Intronic
1078183529 11:9031894-9031916 CAAGAACACACACCATTGGGAGG + Intronic
1078696008 11:13632529-13632551 GAGGAAAAAGCAGCATTTGTAGG + Intergenic
1080976885 11:37353799-37353821 CAGAAATAAACAGAATTTGGAGG - Intergenic
1081903276 11:46648105-46648127 CAGGAAAAAAAAGTGCTGGGGGG - Intronic
1086208853 11:84293906-84293928 CAGAAAAAAACAAAATGGGGAGG + Intronic
1087353031 11:97057728-97057750 CAGGAAAAAATAGCATTACTTGG + Intergenic
1088564071 11:111149083-111149105 CAGGAAGAAACAGTTTTTGGAGG + Intergenic
1088620727 11:111680121-111680143 CAAAAAAAAAAAGCAGTGGGGGG + Intronic
1089873318 11:121696034-121696056 CAGGGAAACAAGGCATTGGGAGG - Intergenic
1090306367 11:125694576-125694598 CAAGAAAAAAGAAGATTGGGAGG - Intergenic
1090328815 11:125913176-125913198 CAGGAAAAAAGAGAAATGGATGG - Intronic
1090440388 11:126720511-126720533 AAGGAAATAAAAGCATTAGGTGG + Intronic
1091688699 12:2581467-2581489 CAGGGAAAAAGAGCATAGAGTGG + Intronic
1093117816 12:15233652-15233674 CAGGATCCAACAGCATTGAGAGG + Intronic
1093327258 12:17792654-17792676 AAGGAGAAAATAGCATTAGGTGG + Intergenic
1093390064 12:18608042-18608064 CAGGAAACAACAGGATGTGGAGG + Intronic
1093523276 12:20075441-20075463 CAGGAACATTCAGCATTGTGTGG - Intergenic
1093531021 12:20163875-20163897 AAGGATAAAACAGGATTCGGGGG + Intergenic
1096422434 12:51470847-51470869 CAAAAAAAAACAGCAGGGGGAGG - Intronic
1097646907 12:62247053-62247075 CAGGAAAAAGAAGCAATGGAAGG - Intronic
1098666161 12:73165691-73165713 CAGGAAAAATTAACTTTGGGAGG - Intergenic
1099216395 12:79859077-79859099 CAGTGAAAAACAACAGTGGGAGG + Intronic
1100226250 12:92559177-92559199 GAGGCATAAACAGCATTGGGTGG - Intergenic
1100500069 12:95165632-95165654 TAGGAAAAAACAAAATTGGCCGG - Intronic
1101256743 12:102985211-102985233 TAGCAAAATGCAGCATTGGGCGG - Intergenic
1102454062 12:113060763-113060785 TAGGAGAAAACAGAATGGGGCGG - Intronic
1103288342 12:119822201-119822223 AAAGAAAAAAGAGCATTGTGTGG + Intronic
1103365050 12:120375985-120376007 CAGGAAATGAAAGCATTGAGAGG + Intergenic
1103432512 12:120901151-120901173 GAGGAAGAAACAGGCTTGGGAGG - Intronic
1103472411 12:121192515-121192537 CAGGCAAGCACAGCCTTGGGAGG + Intergenic
1103805643 12:123570538-123570560 CAGGAAACATCAGCACTGGCTGG - Intergenic
1105468908 13:20673732-20673754 AAAGAAAAAGCAGCAGTGGGAGG - Intronic
1106938968 13:34755160-34755182 GAGGAAAAAACAGGTTTTGGAGG - Intergenic
1107130192 13:36886703-36886725 CAGGAACAAACATGATTGTGGGG + Intronic
1108108689 13:47043607-47043629 CAGGAGAGAACAGCATGAGGGGG - Intergenic
1109875259 13:68394479-68394501 AAGGAGAAAATAGAATTGGGAGG - Intergenic
1109892563 13:68634869-68634891 CAGGAAACAACAGGATGGGCAGG - Intergenic
1110653092 13:77964919-77964941 GAGGAAAAATAAGCATTGAGAGG + Intergenic
1111077531 13:83257356-83257378 CAGTCAAAAGCAGCAATGGGGGG + Intergenic
1111193822 13:84845329-84845351 CAGGAAAAAAAAAAAGTGGGGGG + Intergenic
1112742642 13:102492615-102492637 CAGGCAGCAGCAGCATTGGGAGG + Intergenic
1114827710 14:26101475-26101497 AATGAAAAAACAGCAGTGGCAGG - Intergenic
1115692353 14:35857895-35857917 AAAAAAAAAACAGCATTAGGAGG - Intronic
1118248788 14:64138073-64138095 CAAGAAAAAACAGCATAAGGTGG - Intronic
1118359670 14:65045365-65045387 CAGGAAAAAAAAGTATGGGGAGG - Intronic
1120856252 14:89215056-89215078 CAGACAAAAACAGGATTGGTTGG + Intronic
1122641955 14:103165172-103165194 AAGAAAAAAACAGCTGTGGGAGG - Intergenic
1125874808 15:43134198-43134220 CAGGAAGAGGCAGCATGGGGAGG - Intronic
1126047885 15:44660807-44660829 CACGAAAATACAGGAGTGGGTGG + Intronic
1126088201 15:45028521-45028543 CAGGAAACAACACCATGGAGGGG + Intronic
1126311265 15:47319555-47319577 GAGAAAAAAACAGGATGGGGTGG + Intronic
1127147951 15:56044218-56044240 TATGAAAAAACTGCATTGGAAGG + Intergenic
1128292404 15:66488038-66488060 AAGGAAGAAAGAGCACTGGGTGG - Intronic
1128728201 15:70003249-70003271 GTGGAAGTAACAGCATTGGGAGG + Intergenic
1129314954 15:74736388-74736410 GAGGAAAAATCAAGATTGGGAGG - Intergenic
1129964738 15:79724132-79724154 CATGAAACAACAGAACTGGGAGG - Intergenic
1130140482 15:81222018-81222040 CAGGACAAAAAAACATTTGGGGG - Intronic
1130910960 15:88270460-88270482 CAGGAAAATACAGCAACAGGGGG + Intergenic
1131233929 15:90680344-90680366 CAAGATAAAACAGCATATGGTGG + Intergenic
1131259877 15:90882699-90882721 CAGGGGAAAGCAGCATCGGGTGG - Exonic
1133685811 16:8164577-8164599 CAATAAAAAAGAGCATTGAGGGG - Intergenic
1135620078 16:23948298-23948320 CAGGAAAGACAAGCTTTGGGAGG - Intronic
1136078514 16:27835533-27835555 CAGGAAAGAACAAAATTAGGTGG - Intronic
1137467351 16:48722144-48722166 CAGGAAAGAACAAAATGGGGAGG - Intergenic
1138873964 16:60927035-60927057 CAGAAAAAGACAGCATGGGCAGG - Intergenic
1139830900 16:69797434-69797456 CAGGAGAAAACAGGCTTGAGAGG - Intronic
1140826192 16:78709141-78709163 CATGAAAAAATAGAAATGGGAGG + Intronic
1142069826 16:88085690-88085712 TAGAAAAAAACAGCCTTGCGTGG - Intronic
1143502007 17:7344680-7344702 CTCGAAAATACATCATTGGGTGG - Intronic
1143686656 17:8522837-8522859 CAAGAAAAACAAGCACTGGGTGG - Intronic
1143851636 17:9817266-9817288 CAGGAAAAATCCGCATGGGCTGG - Intronic
1143898911 17:10158307-10158329 AAAGAAAAAACAGGATTGGCCGG - Intronic
1144133018 17:12266215-12266237 GAGGAGACAACAGGATTGGGGGG + Intergenic
1147131199 17:38410320-38410342 GAAGGAAAAACAGCATTGGAAGG - Intergenic
1148298023 17:46519952-46519974 CATGAAATAACAGAATTTGGTGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149333955 17:55615730-55615752 AAGGAAAAAACAGAGTTGGAAGG - Intergenic
1150206508 17:63412584-63412606 AAGGAAAAAGCAGCAGTGAGAGG - Intronic
1150939715 17:69678021-69678043 CAGGAAAAAAAAGAATGGAGTGG - Intergenic
1152894097 17:82900628-82900650 CTGGAAAAGACAGCATGGAGAGG - Intronic
1153494217 18:5681171-5681193 CAGGAATACGCAGCATTGAGAGG - Intergenic
1154979411 18:21490161-21490183 CAGGCAAAAACAAAAGTGGGAGG + Exonic
1155008047 18:21747040-21747062 TAGGAAAAAACAGGATTTGAGGG + Intronic
1156672314 18:39485750-39485772 GAGGAAAAAGAAGCATTGAGAGG - Intergenic
1157074597 18:44451371-44451393 GAGGAAACAACAGCATTGAAGGG - Intergenic
1157437198 18:47680763-47680785 CAGCAAAAGACAGCAGTGGGTGG - Intergenic
1159127006 18:64235529-64235551 TAGTTAAAAACAGCCTTGGGCGG - Intergenic
1159698902 18:71598587-71598609 CATGAAAGAACAGCATGGGTAGG + Intergenic
1159843491 18:73428230-73428252 CAGGAAAAAACACCAAAAGGAGG - Intergenic
1161034021 19:2074035-2074057 AAGAAAAAAACAACTTTGGGAGG + Intronic
1163676919 19:18659981-18660003 CACGAAAGAACAGCGTGGGGAGG + Intronic
1164722563 19:30443489-30443511 CATGAATCAACAGCATTGGCGGG - Intronic
1164862477 19:31573168-31573190 CAGTAAAATACAGCAGTTGGCGG + Intergenic
1164988806 19:32669699-32669721 CAGAAGAAAACAGCAGTGGTCGG + Intronic
1165692593 19:37875199-37875221 CAGGAAAAAATTTAATTGGGAGG + Intergenic
1167273553 19:48520793-48520815 CAGAAAAAAGCAGCTTTGGTGGG - Intergenic
1167866756 19:52335279-52335301 CAAGAAAAAAAAGCAGTTGGTGG + Intergenic
1202675803 1_KI270711v1_random:5509-5531 GATGGACAAACAGCATTGGGAGG - Intergenic
925553612 2:5104139-5104161 CAGGAAAATAAACCATTGGCAGG - Intergenic
925691607 2:6529673-6529695 CAGGCAAACACAGCACTGGTGGG + Intergenic
925731429 2:6921864-6921886 CAGCAAGAAACAGCCTGGGGTGG + Intronic
926544963 2:14228222-14228244 GAGGAAATTACAGCATAGGGGGG - Intergenic
927385797 2:22532576-22532598 CAGCAAAGAACAGGAATGGGGGG - Intergenic
927578549 2:24220770-24220792 CAGGCAGAGACAGCATTTGGAGG + Intronic
927731018 2:25471782-25471804 CAGGAGAAAACATAAATGGGGGG - Intronic
929186416 2:39100011-39100033 CAGAAAAAAACAGTCTTGGCCGG - Intronic
929628015 2:43430193-43430215 CAGGTAAGAAGAGAATTGGGTGG - Exonic
929920954 2:46171221-46171243 CAGGAATAAAGAGCCTTAGGAGG - Intronic
930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG + Intronic
932413200 2:71559266-71559288 CAGGAAAAGACAGTGCTGGGAGG - Intronic
932992996 2:76811412-76811434 AAGGACAAAACAACATTGGCTGG + Intronic
935108250 2:100066799-100066821 CAGGAATAATCAGCATTGTTCGG - Intronic
935789977 2:106582109-106582131 AAGGAAAAGAAAGCACTGGGAGG - Intergenic
936710150 2:115122263-115122285 CAGGGAAAAACAGGGGTGGGAGG - Intronic
936949857 2:117966989-117967011 CAGAAAAAAAAGGCAGTGGGAGG - Intronic
937117869 2:119421657-119421679 CAGGAAAAAAGAGCATTTTCAGG - Intergenic
937671207 2:124539030-124539052 CAGGGAAAAACAGCATTCAAAGG - Intronic
939658110 2:144852844-144852866 ACTTAAAAAACAGCATTGGGAGG - Intergenic
940356693 2:152751503-152751525 GGGGAAGAAACAGCAGTGGGTGG - Intronic
940711599 2:157168992-157169014 CAGAAAAAATCAGCCTTTGGTGG + Intergenic
942465696 2:176205214-176205236 CAGGAAGAAACAGCCTTTGAAGG + Intergenic
942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG + Intergenic
944344821 2:198650096-198650118 AAGGAAAAAACAACATTAGAAGG + Intergenic
944852414 2:203733424-203733446 AAAAAAAAAACAGCATTTGGGGG + Intronic
945856975 2:215080814-215080836 CAGGAAAATAGAGCATCGAGTGG - Intronic
946745682 2:222843214-222843236 CAGAAACATACAGAATTGGGAGG + Intergenic
948599407 2:239099854-239099876 CAGGGCAAAAGAACATTGGGAGG - Intronic
1170007762 20:11687230-11687252 CAGGGGAAAGCAGCATGGGGTGG - Intergenic
1170013505 20:11754737-11754759 CAGGAAAGAAAAGCCCTGGGTGG - Intergenic
1170258999 20:14381634-14381656 CAGTAAAAAATAGCAGTGAGCGG + Intronic
1170458858 20:16558029-16558051 CAGGAAACACCAGCAATAGGGGG + Intronic
1170575909 20:17661338-17661360 CAGGAAGAATCAGTCTTGGGAGG + Intronic
1171124683 20:22591265-22591287 CCGGAAAACACAGCATAGGAGGG - Intergenic
1171416612 20:24985829-24985851 CAGGAAAAAAAACCATTGCCTGG + Intronic
1172837599 20:37883072-37883094 CAGGAAAAAACAGCTGTCAGAGG + Intergenic
1175063085 20:56261520-56261542 GAGCAAAAAACAGCATGGAGAGG + Intergenic
1175239878 20:57539272-57539294 AGTGAAAAAACAGCATGGGGAGG - Intergenic
1175757332 20:61538128-61538150 CTGGAAAATACAGCTTTGGGTGG - Intronic
1178240330 21:30892389-30892411 CAGGAAAAAACAGTATATGTAGG - Intergenic
1179086376 21:38221434-38221456 AAAGAAAAATAAGCATTGGGTGG + Intronic
1179239504 21:39576839-39576861 CAGAAACAAACAGCTTTGTGGGG + Intronic
1179731684 21:43371797-43371819 CAGGAAAACACTCCATTGTGGGG + Intergenic
1180285908 22:10744156-10744178 GAGGAAAAAACAGGGTTGGTAGG + Intergenic
1180744621 22:18078945-18078967 CAGGAATAAACAACCTTGGGCGG - Intronic
1180908955 22:19435044-19435066 CAGGAGAAAGCATCCTTGGGTGG + Intronic
1185202476 22:49516725-49516747 CAGGAAAAAACAGGAAGGGCTGG - Intronic
1203293066 22_KI270736v1_random:14038-14060 CTGGATAAGACAGCATTTGGAGG - Intergenic
951627848 3:24686162-24686184 CAGTAATAAACAGCATTAGCAGG + Intergenic
951936482 3:28028298-28028320 CAGGAACAAATAGGACTGGGAGG + Intergenic
952088974 3:29861319-29861341 CAGGAAAAAATAAGAGTGGGAGG - Intronic
952974695 3:38683677-38683699 AAGAGAAAAACAGCTTTGGGAGG - Intergenic
953290482 3:41656032-41656054 CAGAAAAAAACTGCATGGGTGGG - Intronic
954738791 3:52729812-52729834 CAGAAATAAAAAGAATTGGGTGG + Intronic
956309040 3:67858867-67858889 CATGAAGAAAGAGCATTAGGAGG - Intergenic
957212001 3:77271504-77271526 AAGGAAACATCAGCATTGAGTGG + Intronic
957432156 3:80124464-80124486 CAGGAAAAAAGAAAAGTGGGGGG - Intergenic
957453360 3:80409002-80409024 GAGGCAAAAACATCATAGGGAGG + Intergenic
958415555 3:93869038-93869060 CAGGAAAAAGAAGGATAGGGAGG - Intergenic
960450502 3:117801137-117801159 AAGGAAAGAACATCACTGGGTGG - Intergenic
961082945 3:124042132-124042154 CAGGTTAAAACAGCATTGAAAGG + Intergenic
961984916 3:131122116-131122138 CAGGAAAAAACACAACAGGGAGG - Intronic
963458771 3:145579206-145579228 CAGAAGAAAACAGCATATGGGGG + Intergenic
965453331 3:168866294-168866316 AAGGAAAAAACAGGCTTGGAAGG - Intergenic
965517842 3:169641025-169641047 CAGGAAGAGGCAGCACTGGGAGG + Intronic
967892928 3:194375779-194375801 CAGGGAAAGACAGGAGTGGGAGG - Intergenic
968434712 4:578489-578511 CAGGGAAAAACAGCTTGGAGGGG + Intergenic
969447373 4:7253065-7253087 TAGGAAAAACCAGCCATGGGGGG - Intronic
971005223 4:22366081-22366103 CAGAACAAAACAGCATTATGAGG + Intronic
973538072 4:51904799-51904821 TAGGAAAAAACAGATTTGAGGGG - Intronic
974569980 4:63632530-63632552 CAGGAGAAAATGGAATTGGGTGG + Intergenic
975007906 4:69313420-69313442 CATGACAAGACAGCACTGGGGGG - Intronic
975350055 4:73335783-73335805 CAGAAAAAAACACCATTGGTCGG - Intergenic
975588138 4:75971858-75971880 CAGGAAAAAAGAAAATTAGGTGG + Intronic
976434928 4:85006258-85006280 AAGGAGAAAACAGAATTTGGTGG + Intergenic
977736229 4:100419653-100419675 CAGTAAAAGACAGGATTGGTAGG + Intronic
978687943 4:111470526-111470548 CAGGATAAAATAAAATTGGGTGG - Intergenic
978716926 4:111855675-111855697 CTAGAAAAAACAGTATTTGGAGG - Intergenic
979202372 4:117993855-117993877 CAGGAAAAGACAGAAATGGGAGG - Intergenic
979724095 4:123939905-123939927 CAGGAAAAAAGAACACTGGCGGG - Intergenic
980534047 4:134092195-134092217 TTGGAAAAAGCAACATTGGGTGG - Intergenic
985163717 4:187070414-187070436 CAGGAAAAAACAAGTTTGTGTGG - Intergenic
986200675 5:5575454-5575476 CAGGAAGGAACAGCTGTGGGGGG + Intergenic
986266479 5:6195629-6195651 CAAAACAAAACAGCATGGGGAGG + Intergenic
986539041 5:8825089-8825111 AAGGAAAAAAAAAAATTGGGGGG + Intergenic
987019975 5:13860218-13860240 AAGGAAAAAAGGACATTGGGAGG - Intronic
987586569 5:19863778-19863800 CAGGCAAGAACAACATAGGGAGG + Intronic
988230919 5:28477973-28477995 CAGGAAAAAAAATCATTGAGTGG - Intergenic
990068877 5:51753748-51753770 CTGTAAAAAACAACAGTGGGAGG + Intergenic
991125323 5:63063222-63063244 CAGGAAAAAGAGGGATTGGGTGG - Intergenic
991289830 5:65022886-65022908 GGGGGAAAAACAGCGTTGGGTGG + Intergenic
991641150 5:68754609-68754631 GAGAAGAAAACAGCACTGGGTGG + Intergenic
993055915 5:82979455-82979477 CATGAAAAAAAAGCATTTGAAGG + Intergenic
994096987 5:95856487-95856509 TAGAAAGAAACAGCATTGTGTGG + Intronic
994754153 5:103774266-103774288 CAGGAAAGAACAACTTTGGATGG - Intergenic
998001163 5:138627127-138627149 AAGGAAATAACAGCATTGGCCGG - Intronic
999131447 5:149286555-149286577 CAGAAAAACAAAGCATTAGGTGG - Intronic
999405169 5:151300533-151300555 AAGGAAAAAAGAGCAGAGGGTGG - Intronic
1001032742 5:168274812-168274834 ATGGACAAAAAAGCATTGGGGGG + Intergenic
1001251338 5:170149229-170149251 GAGGTGAAAACAGCATTGGCTGG - Intergenic
1001474903 5:172043778-172043800 CAGGAAGAAAAAGCATCAGGGGG - Exonic
1004020588 6:11772691-11772713 CAGAAGAAAACAGCAATTGGGGG + Intronic
1007791509 6:44311539-44311561 CAGCAGAAACCAGCATGGGGTGG + Intronic
1007990588 6:46251268-46251290 CAGGAAAACACAGTATTGTTGGG - Intronic
1008293047 6:49741298-49741320 CAGGAAAAAACAGCATTGGGAGG - Intronic
1009417475 6:63431768-63431790 CATTAAGAAACAGCATTGGCCGG + Intergenic
1009668024 6:66707902-66707924 CTGGAAACAACAGTATTTGGAGG + Intergenic
1010545416 6:77149486-77149508 CACCAAAAAAGAGCATTTGGGGG - Intergenic
1010974062 6:82293231-82293253 CTGGAAAAAACAGCTCTGGAAGG + Intergenic
1011275411 6:85626574-85626596 CAAGAAAATACACCATTGAGAGG + Intronic
1011513831 6:88130320-88130342 TGTGAAAAAACAGCTTTGGGAGG + Intergenic
1012369239 6:98482568-98482590 CAGGAAACACCAGCATCTGGAGG + Intergenic
1012428940 6:99143872-99143894 GAGGATTAAACAGCAGTGGGTGG - Intergenic
1012700694 6:102453058-102453080 CTGGAAAATACAGACTTGGGGGG - Intergenic
1012852982 6:104469015-104469037 CAGGAATCAACAGATTTGGGTGG + Intergenic
1013160144 6:107535383-107535405 CAGGTAAAGTCAGCAGTGGGAGG + Intronic
1014821716 6:125996091-125996113 TAGCAAAAAACAGGATTGAGTGG - Intronic
1016696726 6:147004716-147004738 CAGGAAATATCAGCAGTGGAAGG - Intergenic
1017860405 6:158392564-158392586 CAGGAGAAAGCAGGATAGGGTGG + Intronic
1018070621 6:160161437-160161459 CAGGAAAGAGCAGGATGGGGTGG + Intergenic
1019375237 7:687729-687751 CAGGATAAACCAGCATAGCGTGG + Intronic
1020472379 7:8553656-8553678 AAGGAAAAGACAGTATTGGGTGG - Intronic
1021764745 7:23936796-23936818 CAGAAAAAAACAGAATTAAGAGG - Intergenic
1023831102 7:44039424-44039446 GAGGAACAAACAGCGGTGGGTGG + Intergenic
1024771247 7:52725750-52725772 CAGGAAACTACAGCTTTGAGAGG + Intergenic
1026344991 7:69466012-69466034 CCAGAAAAAACAGCATTTTGGGG + Intergenic
1027813044 7:82930297-82930319 GAGGGAGAAACAGCATTAGGAGG + Intronic
1027881928 7:83850373-83850395 TTGGAAAAAAGAGCACTGGGAGG + Intergenic
1029409870 7:100402200-100402222 AAGAAAAAAAGAGAATTGGGGGG - Intronic
1029741430 7:102493730-102493752 GAGGAACAAACAGCGATGGGTGG + Intronic
1029759422 7:102592899-102592921 GAGGAACAAACAGCGATGGGTGG + Intronic
1029776789 7:102688809-102688831 GAGGAACAAACAGCGATGGGTGG + Intergenic
1033590260 7:142802847-142802869 CAGGAGAAAGCAGCATTGGGTGG - Intergenic
1034099054 7:148436104-148436126 CAGGAAGAGCCAGCATGGGGAGG + Intergenic
1035195995 7:157220967-157220989 CAGGACAAAACAGAAATGGGTGG - Intronic
1035816935 8:2551349-2551371 AAGGAAAAGTCAGGATTGGGAGG + Intergenic
1036948239 8:13115698-13115720 CAGGAAAAATAAGCATGGCGAGG - Intronic
1037464257 8:19144022-19144044 GAGGAAAACACAGCATTTGCTGG - Intergenic
1038604801 8:28989638-28989660 AAAGGAAAAACAACATTGGGAGG - Intronic
1039983562 8:42429010-42429032 CAGGAAAATGCAGCCTTGGTGGG - Intronic
1041245631 8:55885876-55885898 GAGGAAAACGCAGCATTGGGTGG - Intronic
1041573721 8:59368976-59368998 CAGAATAAACCAGCATTGTGTGG + Intergenic
1042048150 8:64677972-64677994 CAGGTAGAAACAGCATTTGCTGG - Intronic
1042871613 8:73405088-73405110 AAAAAAAAAACACCATTGGGAGG + Intergenic
1043793232 8:84500605-84500627 TAGGAAAAAACTGCATTCTGAGG + Intronic
1044073356 8:87789339-87789361 AAGGAAAAAACAACAGTGGAGGG - Intergenic
1044583456 8:93845715-93845737 CAAGAAAAAAGAGCAGAGGGAGG + Intergenic
1048086072 8:131180976-131180998 ATGGAAAAACCAGGATTGGGGGG + Intergenic
1051126179 9:13808330-13808352 CAGGAAAAAACAGTGCTGAGGGG + Intergenic
1051490347 9:17656950-17656972 CAGAAAAAAAAATCACTGGGTGG + Intronic
1051592838 9:18793945-18793967 AAAGAAAAAACAGACTTGGGTGG + Intronic
1052115529 9:24644895-24644917 TATGAAGAAACAGCATCGGGGGG - Intergenic
1053061150 9:35032894-35032916 AAGGAAAAAAAAGAATTAGGTGG + Intergenic
1054947997 9:70817292-70817314 CAGGAAAAAAGAGCAAGGGGAGG - Intronic
1055030233 9:71766834-71766856 CAGAAAAAAACAGCGTCAGGAGG + Intronic
1056030692 9:82550210-82550232 CAGGAAAAGAGAGTATGGGGTGG + Intergenic
1056296005 9:85193701-85193723 CAGTAACAAACTGCACTGGGGGG + Intergenic
1057784869 9:98079532-98079554 GAAGCAAAAACAGGATTGGGAGG - Intronic
1059050971 9:110925186-110925208 CAGGAAAAAACTGTATTTTGGGG - Intronic
1059392852 9:114009831-114009853 GAGGAAGAAAAAGCATTTGGGGG - Intronic
1059460636 9:114427492-114427514 CAAGAATAACCAGCATTGTGAGG - Intronic
1060477306 9:123996547-123996569 CAGGTAGAAACAGACTTGGGAGG + Intergenic
1061206245 9:129165241-129165263 CAGGAAATAACTGGATTTGGGGG + Intergenic
1185499664 X:587174-587196 CAGAAAAAAACAGAAGTAGGAGG - Intergenic
1186720389 X:12297503-12297525 TGGGAAAAAACAGAATTGTGGGG + Intronic
1187726756 X:22211270-22211292 CAGGAAAAAATGCCATTGAGGGG + Intronic
1188377618 X:29451791-29451813 CAGAACAAAACAGTATTTGGTGG + Intronic
1189238735 X:39509090-39509112 CAGGACATAAAAGCATTGAGAGG - Intergenic
1189723403 X:43943951-43943973 CAGTAAAGAACAGTTTTGGGTGG + Intergenic
1189945124 X:46170207-46170229 CAGTAAAATACACCTTTGGGGGG + Intergenic
1190966208 X:55303785-55303807 CATGAAGAAACTGCATTGGGCGG - Intergenic
1193259951 X:79393474-79393496 AAGAAAAAAACAAAATTGGGAGG - Intergenic
1195001600 X:100648145-100648167 CAGGAATAATCAGCAGTGGCTGG + Intronic
1199804359 X:151283058-151283080 CAGGATAAAACAGAACTGGAAGG + Intergenic
1200150483 X:153949007-153949029 CAGGAACGCACAGCCTTGGGAGG + Exonic
1200426135 Y:3022360-3022382 CAGGCAAAAACAGCATGGTAAGG - Intergenic
1202628679 Y:56886348-56886370 GAGGAAAAAACAGGGTTGGAAGG - Intergenic