ID: 1008297777

View in Genome Browser
Species Human (GRCh38)
Location 6:49799040-49799062
Sequence TTTCAAGTGCATACAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008297777_1008297780 4 Left 1008297777 6:49799040-49799062 CCCTCCACTGTATGCACTTGAAA No data
Right 1008297780 6:49799067-49799089 GCCTATCCATGAGTGTGATCAGG No data
1008297777_1008297782 8 Left 1008297777 6:49799040-49799062 CCCTCCACTGTATGCACTTGAAA No data
Right 1008297782 6:49799071-49799093 ATCCATGAGTGTGATCAGGATGG No data
1008297777_1008297785 30 Left 1008297777 6:49799040-49799062 CCCTCCACTGTATGCACTTGAAA No data
Right 1008297785 6:49799093-49799115 GAGTTAATTGGAGCAGCAGTTGG No data
1008297777_1008297784 18 Left 1008297777 6:49799040-49799062 CCCTCCACTGTATGCACTTGAAA No data
Right 1008297784 6:49799081-49799103 GTGATCAGGATGGAGTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008297777 Original CRISPR TTTCAAGTGCATACAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr