ID: 1008299557

View in Genome Browser
Species Human (GRCh38)
Location 6:49818437-49818459
Sequence CTTTTCTTCCTTAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008299557_1008299562 19 Left 1008299557 6:49818437-49818459 CCATTTGTCCTAAGGAAGAAAAG No data
Right 1008299562 6:49818479-49818501 TGTAGCTGGCCCACTTCCATTGG No data
1008299557_1008299560 5 Left 1008299557 6:49818437-49818459 CCATTTGTCCTAAGGAAGAAAAG No data
Right 1008299560 6:49818465-49818487 AAGAGCAGAATACCTGTAGCTGG No data
1008299557_1008299563 26 Left 1008299557 6:49818437-49818459 CCATTTGTCCTAAGGAAGAAAAG No data
Right 1008299563 6:49818486-49818508 GGCCCACTTCCATTGGAATATGG No data
1008299557_1008299564 27 Left 1008299557 6:49818437-49818459 CCATTTGTCCTAAGGAAGAAAAG No data
Right 1008299564 6:49818487-49818509 GCCCACTTCCATTGGAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008299557 Original CRISPR CTTTTCTTCCTTAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr