ID: 1008302075

View in Genome Browser
Species Human (GRCh38)
Location 6:49853559-49853581
Sequence TTTGGGAGGTATGGTGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008302075_1008302083 9 Left 1008302075 6:49853559-49853581 CCCAAAACACCATACCTCCCAAA 0: 1
1: 0
2: 3
3: 21
4: 250
Right 1008302083 6:49853591-49853613 CAAGCATTTCCCTGCCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008302075 Original CRISPR TTTGGGAGGTATGGTGTTTT GGG (reversed) Intronic
901865969 1:12106874-12106896 TTTGGGAAGTTTGGCCTTTTTGG - Intronic
901919410 1:12525666-12525688 TGTGGGAGGGAGGGTGGTTTTGG + Intergenic
902221223 1:14967154-14967176 TATGTGAAGTGTGGTGTTTTAGG + Intronic
903400369 1:23040839-23040861 TTTTGTAGGTTTGGTGGTTTGGG + Intronic
903652017 1:24928398-24928420 TTTGGGGGAGATGGTGTTTAGGG - Intronic
903915252 1:26759166-26759188 CTTGAGATGTGTGGTGTTTTCGG + Intronic
904393573 1:30202373-30202395 TTTGGGAGGTGTGCGCTTTTGGG - Intergenic
909479860 1:76119517-76119539 TATGTGAGGGATGGTGTATTTGG + Intronic
909804345 1:79856438-79856460 TTTTGTAGGTATGCTTTTTTTGG - Intergenic
909912442 1:81277711-81277733 ATTAGGAGGTAGGGTCTTTTAGG - Intergenic
911275970 1:95858822-95858844 TTTGGGAGGTATTTAGGTTTGGG + Intergenic
911406071 1:97441231-97441253 TTTGGGAGGTTTGTAGTTTTAGG + Intronic
911618615 1:100041450-100041472 TTTGGGAAGTATGGACCTTTTGG - Intronic
914864999 1:151419496-151419518 TTTGGGGGGTTTTTTGTTTTGGG - Intronic
916320024 1:163493739-163493761 TTTGGTGGGTATGGTATTCTTGG - Intergenic
916398264 1:164415762-164415784 TTTGGGTTGTTTGGAGTTTTTGG - Intergenic
916803229 1:168233637-168233659 TTTGGGTGGGGGGGTGTTTTGGG + Intronic
917858993 1:179127285-179127307 TCTGGAAGGGATTGTGTTTTGGG - Intronic
917918491 1:179728614-179728636 TTTGGGAGGGTTGATGTTTGTGG + Intergenic
918206287 1:182312403-182312425 CAGGGGAGGTGTGGTGTTTTAGG - Intergenic
920026959 1:203006124-203006146 TTTTGGAGGTATGGTGTGTTAGG + Intergenic
920061244 1:203228455-203228477 TCTGGCAGGGAAGGTGTTTTGGG + Intronic
922514882 1:226199915-226199937 TTTGGGAGGTAAGCTGTATACGG - Intergenic
923729263 1:236534792-236534814 TTTGGGAGGTAATGAGCTTTGGG - Intronic
923832972 1:237578612-237578634 TTTTGGAGGTATTATTTTTTTGG + Intronic
924225492 1:241918463-241918485 TTTTGCAGGTATGGTCTTTGCGG - Intergenic
924576998 1:245289951-245289973 TTTGGGAGGGAGGGTATTTTGGG - Intronic
1064727222 10:18292700-18292722 TCTGGTAGGTTTTGTGTTTTTGG - Intronic
1065903669 10:30229479-30229501 TTTGGGGGGTGTGGTGATATGGG + Intergenic
1068142753 10:53027600-53027622 TTAGGGAGGTATGCTTTCTTAGG + Intergenic
1069363046 10:67665884-67665906 TTTGGGATTTACAGTGTTTTGGG - Intronic
1070523968 10:77279039-77279061 TTTGGGGGGTGTGTTGTTGTTGG + Intronic
1071468639 10:85962727-85962749 TTTGGGAGGTACTGGGTTTGGGG + Intronic
1072060412 10:91804737-91804759 TTTGGGAAGTATGGTTTTTTGGG + Intronic
1077811643 11:5643829-5643851 CTTGAGATGTATGGTGTATTTGG + Exonic
1077991281 11:7414563-7414585 TTTGGGAGATATGGGGGCTTGGG - Intronic
1078872941 11:15365776-15365798 TGTGGGAGGTTAGGTGATTTGGG + Intergenic
1079969176 11:27015554-27015576 TTTAGGAGGTAGGGTCTTTGAGG - Intergenic
1080259814 11:30335828-30335850 TTTCGGAGGTATTGTGGGTTTGG - Intronic
1083461124 11:62812753-62812775 TCAGGGAGCTATGGTGTTTATGG + Intronic
1087495278 11:98883280-98883302 TTTGGGCAGTATGGTGATTTTGG - Intergenic
1088018760 11:105092937-105092959 TTTGGAAGGAAGGGTGTTATTGG + Intronic
1091466000 12:685220-685242 TTTGGGAGGTAGAAGGTTTTTGG - Intergenic
1092124925 12:6068332-6068354 TTTGGGAGGTAGAGGGTTGTGGG - Intronic
1092276421 12:7064564-7064586 TTTGGGGGTACTGGTGTTTTTGG + Intronic
1094034200 12:26049069-26049091 TTTTTAAGGTATGGTGTTCTGGG + Intronic
1095636221 12:44436752-44436774 GTTGGGAGGTGTGGTTGTTTGGG + Intergenic
1096614712 12:52825279-52825301 TATGGGAGGTGTTGGGTTTTAGG - Intronic
1096967990 12:55643797-55643819 TTTGGGGGGTATGGGGATGTGGG + Intergenic
1097293182 12:57937111-57937133 ATTTGGAGGTTTTGTGTTTTGGG - Intergenic
1097984831 12:65772012-65772034 TTTGGGAGATATAGTGGATTAGG - Intergenic
1098132495 12:67365035-67365057 TTTGGGGGGTATTGTGTGCTAGG + Intergenic
1099633428 12:85179788-85179810 TGTGGGAGGCTTGGTGTATTAGG - Intronic
1100035740 12:90249340-90249362 TTTGTGAGGTATATTGTATTTGG + Intergenic
1102764937 12:115424095-115424117 TTTGGGAGATATGGAGTTAAAGG - Intergenic
1104960705 12:132487450-132487472 CTTGGGAGGGATGGTGGTTCTGG - Intergenic
1105447523 13:20470571-20470593 TCTGGGAGGAATGAAGTTTTGGG - Intronic
1105649907 13:22365119-22365141 TTTTGGAGGTGGGTTGTTTTTGG - Intergenic
1105951301 13:25231600-25231622 TTTGGGAGATGTAGTGTTTGTGG - Intergenic
1107267220 13:38570290-38570312 TTTGGGAGGTTGTGTGTTTCTGG - Intergenic
1107523479 13:41206132-41206154 ATTTGGAGGTAGGGTGTTTGAGG + Intergenic
1107834017 13:44399019-44399041 TTTGGGAGGTATGCTTGTATGGG - Intergenic
1108995923 13:56735368-56735390 TCAGGGAGGTATGGTGTTATTGG - Intergenic
1110384796 13:74897002-74897024 TGTGGGAGATTTGGTTTTTTTGG + Intergenic
1110981611 13:81907049-81907071 TTAGGGAGCCATGGTGATTTTGG - Intergenic
1112341212 13:98554264-98554286 TTTGGGAAGTATGGACTCTTTGG - Intronic
1112938212 13:104827295-104827317 TTTGGAAGGAAAAGTGTTTTTGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114201905 14:20529069-20529091 TTTAGGCTGTATGGTGTTATTGG - Intergenic
1114857487 14:26466703-26466725 TTTGGGAGGTGGGGCCTTTTGGG + Intronic
1115960003 14:38825044-38825066 GTTGGGAGGTGGGGAGTTTTGGG - Intergenic
1117661121 14:58005970-58005992 TTTTGGAGGTATCGTGTTGTTGG - Intronic
1120544937 14:85799440-85799462 TTTGGAAGGAATGGTCTTTATGG + Intergenic
1121902396 14:97705956-97705978 TTTGGAAGGAATGTTGTTTTGGG - Intergenic
1122375205 14:101252675-101252697 TTTGGGATGAATCGGGTTTTAGG - Intergenic
1124058531 15:26265170-26265192 TGTGAAAGGTATGGTGTGTTTGG - Intergenic
1125254597 15:37748740-37748762 TTTGGGAGGTTGTGTTTTTTGGG - Intergenic
1126394846 15:48203809-48203831 TTTGGGGGGTGGGGTGGTTTGGG + Intronic
1127037479 15:54933824-54933846 GTTGGGAGGTATGGTCTGGTGGG - Intergenic
1127592725 15:60442784-60442806 GTGGGGAGGTATGTTGATTTTGG - Intronic
1130398566 15:83528055-83528077 TTTGCTAGGTATAGTATTTTTGG + Intronic
1130829787 15:87587506-87587528 TTTGGTAGGTATGGTTATGTGGG - Intergenic
1133430935 16:5736260-5736282 TTTGGGAAGTATGGGGTATAGGG + Intergenic
1133455439 16:5938504-5938526 TTAGGGAGGTATGGAGAATTGGG - Intergenic
1134254718 16:12601568-12601590 CTTGGAAGGTATGGGGTTCTGGG + Intergenic
1137800653 16:51259353-51259375 TTTGGAAGGTATTGGGCTTTGGG + Intergenic
1138751229 16:59423876-59423898 TTTGGGATGTCTGGCTTTTTGGG + Intergenic
1138849770 16:60613449-60613471 ATTGGGAGGTGTGGCCTTTTGGG - Intergenic
1139025707 16:62815629-62815651 TTTGGGAGGTAAGGTAGGTTTGG + Intergenic
1139472533 16:67185825-67185847 CTTGGGTGGTATGTTCTTTTTGG - Intronic
1140186433 16:72776756-72776778 TTTGGAAGGTAGGCTGGTTTTGG + Intergenic
1140282612 16:73568469-73568491 TTTGGGAGCTCTGGTCTGTTTGG - Intergenic
1143304911 17:5938812-5938834 GGAGGGAGGTATTGTGTTTTTGG + Intronic
1143641339 17:8199829-8199851 GTGGGGAGCTTTGGTGTTTTCGG + Intergenic
1145211486 17:21016507-21016529 TTTGGGTGGTCTGTGGTTTTGGG - Intronic
1146178809 17:30684296-30684318 TTTAGTAGGGATGGGGTTTTTGG + Intergenic
1146540629 17:33690627-33690649 TTTGAGAGGTATGGTTTGTTGGG + Intronic
1146734148 17:35222946-35222968 TTGGGGAGATGTGGTGATTTTGG - Intergenic
1148593962 17:48837905-48837927 TTTGGGAGGTCTTGTTTTTTTGG + Intronic
1149232499 17:54551848-54551870 TTTGCTAGATATGGTATTTTTGG + Intergenic
1151611788 17:75181506-75181528 TTTGGGGGGTAAAGTATTTTGGG - Intergenic
1154471266 18:14704013-14704035 TCTGGGAGGTATGATGCTATTGG - Intergenic
1155482832 18:26308081-26308103 TTTGGGGGGTTTTTTGTTTTTGG - Intronic
1156085459 18:33394726-33394748 TTTGGGAGATAATGTGCTTTAGG - Intronic
1157019114 18:43757894-43757916 TTTGGGAGGGGGTGTGTTTTAGG - Intergenic
1157165578 18:45355629-45355651 TTGGGGAGGAAAGGTATTTTTGG + Intronic
1157700946 18:49761373-49761395 TTTGGGGGGTATGGGGTGTGGGG - Intergenic
1160361138 18:78280338-78280360 TTTGGGAGGTTGTGTGTTTCTGG + Intergenic
1160614590 18:80115128-80115150 GTTGGAAGGTATTGTGTGTTTGG + Intronic
1162751546 19:12832950-12832972 TTTGGGAAGCATGGTGGGTTTGG + Intronic
1162979805 19:14231271-14231293 TTTAGTAGGGATGGGGTTTTTGG - Intergenic
1165396547 19:35567355-35567377 TGTGGGAGGTCTGGAGTCTTAGG - Intergenic
1168432999 19:56296014-56296036 TTTGGGAGGAATGCTTTTTAGGG + Intronic
926821528 2:16855942-16855964 TTTGTGAAGTATGTTGTTCTAGG + Intergenic
927758279 2:25726219-25726241 GTTGGGAGGTAGGGGCTTTTAGG - Intergenic
928149317 2:28811355-28811377 TGTGGGAGGAATGGAGATTTGGG + Intronic
928510212 2:31995987-31996009 TTTGGTAGGTATTAAGTTTTTGG - Intronic
928513396 2:32022406-32022428 TATGGGAGGTATTATGTTTTTGG - Intronic
928844914 2:35659734-35659756 ATTGGGAGGTGGGGTCTTTTGGG - Intergenic
929860275 2:45671111-45671133 TTTGGAAGATAAGGTGTTTGCGG + Intronic
930944974 2:57062382-57062404 ATTGGGAGGTATGGAATATTGGG - Intergenic
931236132 2:60413902-60413924 TATGGGAGGGCTTGTGTTTTGGG - Intergenic
931409939 2:62019542-62019564 GTTGGGAGGTAGGGCCTTTTGGG - Intronic
935390589 2:102548333-102548355 TTTGGGATATATGGTGATTATGG - Intergenic
936760231 2:115769864-115769886 TTTGGGAAGTGTGATATTTTAGG - Intronic
936766658 2:115858192-115858214 TTTGGTAGGTATGGTATTCTTGG + Intergenic
937147085 2:119656765-119656787 TTTTGGAGGTGTGGTGTGGTGGG + Intronic
940292907 2:152095134-152095156 TTTAGGAGGGATGGAGGTTTTGG - Intronic
940531744 2:154886560-154886582 TGTAGGAGGGATGGGGTTTTTGG + Intergenic
941843230 2:170109687-170109709 TTTGGTAGTTCTGGTGTTTGGGG + Intergenic
943118124 2:183699096-183699118 TTTGCCAGGTATAGTATTTTTGG - Intergenic
945694062 2:213080330-213080352 TTTGGGAGGGAAAGTATTTTGGG + Intronic
947845851 2:233243167-233243189 TTTTGGAGTTATGATTTTTTGGG + Intronic
948277304 2:236718996-236719018 TTTGGTTGGTTTGGTTTTTTTGG + Intergenic
1170056650 20:12212623-12212645 TTTGAGAGGTAATGAGTTTTAGG + Intergenic
1170111841 20:12812899-12812921 TTTGGGCAGTATGGTTATTTTGG - Intergenic
1171106763 20:22440919-22440941 TTTGGGAGTGATGGTGGCTTTGG + Intergenic
1172098655 20:32473047-32473069 CTGGGGAGGTCTGGTGATTTGGG - Intronic
1176803225 21:13453929-13453951 TCTGGGAGGTATGATGCTATTGG + Intergenic
1178160763 21:29911628-29911650 TTTGGGAGGTAATATGGTTTAGG + Intronic
1178530848 21:33374413-33374435 TTTGGGATGTATACTGCTTTTGG + Intergenic
1179613715 21:42568458-42568480 TCTGGGAGGTTTGGTGTCTTAGG + Intronic
1179777899 21:43679238-43679260 TTTTGGTGTTTTGGTGTTTTGGG + Intronic
1180225712 21:46390971-46390993 TTTGGGAGGAATGGGGTGGTCGG + Intronic
1180885936 22:19243618-19243640 TTTGGGGGTTTTGGTTTTTTTGG - Intronic
1182092565 22:27605821-27605843 TTTCAGAGGTTTGGTGGTTTAGG - Intergenic
1182120912 22:27786102-27786124 TTTTTGAGAAATGGTGTTTTCGG - Intronic
1182529222 22:30942309-30942331 TTTGGGAGGAAGGCTGTTCTGGG - Intronic
950297885 3:11847649-11847671 TTTGAGAGGTAGTGTATTTTGGG - Intergenic
951677486 3:25258564-25258586 TTTGGAATGTATAGTGGTTTTGG + Intronic
952419943 3:33121821-33121843 TTTGGGAGATATGATCTCTTGGG + Intronic
953809893 3:46103275-46103297 TCTGGGAGGGATGGAGTGTTTGG + Intergenic
954500110 3:51005519-51005541 TTTGGGAGCTATTGAGTTTGAGG - Intronic
956953151 3:74305694-74305716 CTTTGGAGGTATGGTAGTTTTGG + Intronic
957140930 3:76355770-76355792 TTTGGGAGCTACGATTTTTTTGG + Intronic
958054253 3:88389010-88389032 TTTGGGTGGTTTGGGGTTTACGG - Intergenic
959493189 3:107017188-107017210 TTTGGGTAGTATGGAGATTTGGG + Intergenic
959707206 3:109349153-109349175 ATTGGGAGGTAGGGCCTTTTGGG - Intergenic
960331900 3:116370172-116370194 TTTTGTAGTTATAGTGTTTTGGG + Intronic
961686161 3:128632955-128632977 TTTGGGAAGCAAGGTGTGTTGGG - Intronic
964497047 3:157302431-157302453 TTTGGGAGGTATTAAGTCTTGGG + Intronic
964528661 3:157643658-157643680 TTTGGGAAGAAGGGTGTGTTAGG + Intronic
965358035 3:167701603-167701625 ATTTAGAGGTGTGGTGTTTTGGG - Intronic
965616831 3:170602227-170602249 TTTGGGTGGGAAGGTGATTTGGG + Intronic
970382899 4:15525792-15525814 TATGGGAGTTGTGGTCTTTTGGG + Intronic
970462970 4:16294071-16294093 TTTGGGATGTATGGAGTTCAGGG - Intergenic
970947995 4:21717530-21717552 TTGGGGAGGTATGGTCTCATTGG - Intronic
972482865 4:39514540-39514562 TTTGGCAGAGATGGGGTTTTGGG + Intronic
972650642 4:41014223-41014245 TTTGGGAGGTGTGCTGTTCTTGG + Exonic
972767086 4:42161148-42161170 TTTGGGAGGAATGTTTCTTTAGG - Intergenic
974754837 4:66189879-66189901 TTTGGGAGGTGGGGTGGTTGTGG - Intergenic
975030757 4:69612456-69612478 GTTGGGTAGTATGGTGCTTTCGG - Intronic
975746382 4:77479595-77479617 TTTGGGAGATACGGACTTTTTGG - Intergenic
977071126 4:92389103-92389125 TTTAGGAAGTTTGGTGTTTTAGG + Intronic
977565243 4:98574181-98574203 TTTGAGAGGTTGGCTGTTTTTGG - Intronic
978609259 4:110519217-110519239 TTTAGGAGGTAACGTGATTTAGG + Intronic
979492988 4:121350659-121350681 TTTGGAAGGTATTTTATTTTTGG + Intronic
980302001 4:131007645-131007667 TTTAGGAGGTTTGGTTTTTGAGG - Intergenic
980936945 4:139234585-139234607 TTTAGGAGGTTTGGTTTTTGGGG - Intergenic
987760791 5:22160818-22160840 ATTTGGAGGTAAGGTCTTTTAGG - Intronic
988333265 5:29871299-29871321 TCAGGGAGGTATGGCTTTTTGGG - Intergenic
991386730 5:66099211-66099233 TTTGCCAGATATGGTATTTTTGG - Intergenic
991613274 5:68469926-68469948 TTTGGTAAGGATGGTGTCTTAGG - Intergenic
991895568 5:71394271-71394293 ATTTGGAGGTAGGGTCTTTTAGG - Intergenic
991941633 5:71858726-71858748 TCTAGGAGGCATGGTGTTTCTGG + Intergenic
993115969 5:83721234-83721256 TTCGGGAGGTGTGGTGTGGTGGG - Exonic
993840431 5:92871351-92871373 TTTGGGTAGTATGGTCATTTTGG + Intergenic
995267781 5:110184033-110184055 TTTGCTGGGTATGGTGTTCTTGG - Intergenic
996346027 5:122489539-122489561 TTTTGGAGGAATGGTTTTTATGG - Intergenic
996397575 5:123028629-123028651 TTTGAGAAGGATGGAGTTTTGGG - Intronic
1000284522 5:159815630-159815652 ATTGGGAGGTAGGGTCATTTGGG + Intergenic
1000663464 5:163965111-163965133 TTTTTCAGGGATGGTGTTTTAGG + Intergenic
1003500127 6:6696372-6696394 TTTGGGAGGTCTGGGGCTTGGGG + Intergenic
1004459931 6:15826367-15826389 TTTGGGTGGTTTTGGGTTTTGGG - Intergenic
1005919424 6:30386601-30386623 TTTGGGGGGTGTTGTTTTTTTGG - Intergenic
1006202056 6:32302468-32302490 TTTGGTTTGTTTGGTGTTTTTGG - Intronic
1008302075 6:49853559-49853581 TTTGGGAGGTATGGTGTTTTGGG - Intronic
1009029769 6:58042723-58042745 ATTGGGAGGTATGGTTAGTTGGG + Intergenic
1009192354 6:60644470-60644492 TTTGGGTTGTATCTTGTTTTTGG + Intergenic
1009248364 6:61268694-61268716 CTTGTGAGATATGGTGTTTCCGG - Intergenic
1009401398 6:63260219-63260241 TCTTGGAGGTATTGTGTGTTGGG + Intergenic
1011558278 6:88590919-88590941 TTTGAGAGGAATGGGGTTTGGGG + Intergenic
1011964336 6:93135161-93135183 TTTCTGCGGTATGGTGTATTTGG + Intergenic
1012390786 6:98737285-98737307 TCTGGGAGGTGGGGTCTTTTGGG - Intergenic
1012713209 6:102634831-102634853 TATAGGAGGTATGGTGATATTGG + Intergenic
1013631452 6:111989924-111989946 TTTGAGAGGTATGGGGTATTGGG + Intergenic
1014481420 6:121942683-121942705 TTTGCTAGATATTGTGTTTTTGG + Intergenic
1015121826 6:129708509-129708531 TTTGGAAGGTCTGGAGTTCTAGG - Intronic
1016155478 6:140801580-140801602 TTTGGGGGGTATAATGTATTTGG + Intergenic
1016264789 6:142220136-142220158 TTTAGGAGGCATGTTGTTTGGGG - Exonic
1016481383 6:144485380-144485402 TTTAGGAGGTCTGGTCTTGTTGG + Exonic
1017402540 6:154080775-154080797 CTTTGGATGTATGGTGTTGTGGG - Intronic
1019053288 6:169201042-169201064 TTTGGGATGGATGGTGTTGTTGG - Intergenic
1020967839 7:14894832-14894854 TATGGGAGGACTGTTGTTTTGGG - Intronic
1022388682 7:29925024-29925046 TGTGTGGTGTATGGTGTTTTGGG - Intronic
1023249605 7:38243389-38243411 TTCTGGAGGTATAGTGTTTCCGG + Intergenic
1023249820 7:38246155-38246177 TTCTGGAGGTATAGTGTTTCTGG + Intergenic
1023251196 7:38263107-38263129 TTCTGGAGGTATAGTGTTTCTGG + Intergenic
1024634236 7:51274240-51274262 TTTGGGAGGGAAGGTGTGTTTGG - Intronic
1024702731 7:51922172-51922194 TTTGGGAGGCCAAGTGTTTTGGG + Intergenic
1026251640 7:68676250-68676272 TATGAGAGGTATGGAGTTGTTGG + Intergenic
1026420426 7:70231187-70231209 TTTGGAAGGTCTGCTGTCTTGGG + Intronic
1026542607 7:71293698-71293720 TTTGCAGGGTATAGTGTTTTAGG + Intronic
1026549335 7:71354133-71354155 TGTTGGAGGTAGGGTGTGTTAGG - Intronic
1027177982 7:75916485-75916507 TTTGGGAGGAGGGCTGTTTTAGG + Intronic
1027389437 7:77690755-77690777 TTTGGCTTGCATGGTGTTTTAGG + Intergenic
1027607271 7:80315773-80315795 TTTGGGTGGTTTCATGTTTTTGG + Intergenic
1029349850 7:100005434-100005456 TCGGGTAGGTTTGGTGTTTTGGG - Intergenic
1029408791 7:100395247-100395269 ACTGGGAGGTAGTGTGTTTTGGG + Intronic
1029663549 7:101979587-101979609 TTTAGGAGGTTTGTTGGTTTGGG + Intronic
1029834569 7:103296065-103296087 TCTGGGTGGTTTGGAGTTTTGGG + Intergenic
1030711772 7:112758129-112758151 TTTGGTAGGTATGGTTGTTCTGG - Intergenic
1031228775 7:119076903-119076925 TTAAGGAGGTATGGTGTTTTAGG - Intergenic
1031296183 7:120007657-120007679 TTTGCCAGGTATGGTATTCTTGG + Intergenic
1033000289 7:137496366-137496388 TTTGGGAGGTATGGCCATTTTGG - Intronic
1034036148 7:147824687-147824709 TTTGGGTGATATTGTGTTTTGGG - Intronic
1035933683 8:3812723-3812745 TTGGGGAGATGTGGTGTTTGTGG - Intronic
1036917659 8:12820330-12820352 TCTGGGAGGTGGGGGGTTTTGGG - Intergenic
1037540525 8:19866368-19866390 TTCAGCATGTATGGTGTTTTGGG + Intergenic
1040812045 8:51464601-51464623 TTTGGGAGGTTGTGTGTTTATGG - Intronic
1041288942 8:56289919-56289941 TTTGGAATGTTTGGTGATTTTGG + Intergenic
1043988173 8:86718673-86718695 TTTGGGTGGTAGAGTGTTATTGG - Intronic
1044313559 8:90724444-90724466 TTTGGGTGGTATAGTTTTGTAGG + Intronic
1044954194 8:97462549-97462571 TTTGGGAGGTTTTCTGCTTTGGG + Intergenic
1045445004 8:102252034-102252056 TATGGGAGGGATGTTGTTTGGGG + Intergenic
1045817495 8:106293846-106293868 GTTGGGAGACAGGGTGTTTTGGG - Intronic
1046116930 8:109795983-109796005 TTTCAGAGGTATGGTTTTCTTGG - Intergenic
1046242599 8:111516327-111516349 TTTGAGAGGCATGGTGTGTGTGG - Intergenic
1046618389 8:116501813-116501835 TTTGGGAAGCATGGTGTGCTGGG - Intergenic
1048226560 8:132592882-132592904 TTTGGGAGGTATAGTAAGTTTGG + Intronic
1048767922 8:137864313-137864335 TTTTGGATGTATGGTATGTTTGG - Intergenic
1048780312 8:137992095-137992117 TTAGGGAGGTGTGCTTTTTTAGG - Intergenic
1051724338 9:20073255-20073277 TGTAGAAGTTATGGTGTTTTGGG + Intergenic
1052782249 9:32793643-32793665 GTTGGGAGGTAGGGCCTTTTGGG + Intergenic
1053044237 9:34900726-34900748 TTTGGGAGGTGGGGCCTTTTGGG + Intergenic
1053315335 9:37046300-37046322 TTTGGAAGGGATGGTGGTTTTGG + Intergenic
1055388724 9:75795098-75795120 TTTGTGTGTTTTGGTGTTTTGGG - Intergenic
1056389226 9:86125395-86125417 TTTGGGTGGTTTTCTGTTTTGGG - Intergenic
1057059859 9:91994115-91994137 GGTGGGGGGTATGGTGTTTTGGG - Intergenic
1057427970 9:94969257-94969279 TTTTGGAGGTATCCAGTTTTAGG + Intronic
1057547101 9:96026952-96026974 TTTGTGCGGTGTGGTGTGTTTGG - Intergenic
1058136075 9:101309037-101309059 TTTGGAAGAAATGGTGATTTGGG + Intronic
1061084490 9:128391149-128391171 TTTGGGTGGGATGATGCTTTTGG - Exonic
1185674128 X:1835084-1835106 ATTGGGAGGTATCGTGGATTTGG - Intergenic
1187948067 X:24445922-24445944 ATTGGGAGGTGTGGCCTTTTGGG - Intergenic
1188434332 X:30143212-30143234 TTTGGGACACATGGTGTGTTAGG - Intergenic
1190074393 X:47305546-47305568 GTTGGGAGGTGGGGTCTTTTGGG + Intergenic
1190272660 X:48878468-48878490 GTTGGGAGGTGGGGTCTTTTGGG - Intergenic
1190394196 X:49963232-49963254 TTTGGGAAGTATGTGGTTTAAGG + Intronic
1190718541 X:53127094-53127116 TTTAGGAGGAAGGGTGTTTCAGG - Intergenic
1192983572 X:76372370-76372392 TTTAGGAGGTTTGGTTTATTGGG - Intergenic
1193258109 X:79374014-79374036 GTTGGAAGGTATGGTGTTGGAGG - Intergenic
1193872665 X:86820857-86820879 CTTGGGAGGAATGTTGTTTTAGG - Intronic
1196978705 X:121187878-121187900 TTTGGGACGTATTAGGTTTTAGG + Intergenic
1197566272 X:128091504-128091526 TTTGGCAGGGTTGGTATTTTAGG - Intergenic