ID: 1008307295 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:49918820-49918842 |
| Sequence | TAGCCGTGTCACTGTCATTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008307295_1008307303 | 27 | Left | 1008307295 | 6:49918820-49918842 | CCAGAATGACAGTGACACGGCTA | No data | ||
| Right | 1008307303 | 6:49918870-49918892 | CATCCCAGGCAAGATCAGAAGGG | No data | ||||
| 1008307295_1008307299 | 13 | Left | 1008307295 | 6:49918820-49918842 | CCAGAATGACAGTGACACGGCTA | No data | ||
| Right | 1008307299 | 6:49918856-49918878 | CACTTCCACCAGCTCATCCCAGG | No data | ||||
| 1008307295_1008307302 | 26 | Left | 1008307295 | 6:49918820-49918842 | CCAGAATGACAGTGACACGGCTA | No data | ||
| Right | 1008307302 | 6:49918869-49918891 | TCATCCCAGGCAAGATCAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008307295 | Original CRISPR | TAGCCGTGTCACTGTCATTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||