ID: 1008307295

View in Genome Browser
Species Human (GRCh38)
Location 6:49918820-49918842
Sequence TAGCCGTGTCACTGTCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008307295_1008307303 27 Left 1008307295 6:49918820-49918842 CCAGAATGACAGTGACACGGCTA No data
Right 1008307303 6:49918870-49918892 CATCCCAGGCAAGATCAGAAGGG No data
1008307295_1008307299 13 Left 1008307295 6:49918820-49918842 CCAGAATGACAGTGACACGGCTA No data
Right 1008307299 6:49918856-49918878 CACTTCCACCAGCTCATCCCAGG No data
1008307295_1008307302 26 Left 1008307295 6:49918820-49918842 CCAGAATGACAGTGACACGGCTA No data
Right 1008307302 6:49918869-49918891 TCATCCCAGGCAAGATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008307295 Original CRISPR TAGCCGTGTCACTGTCATTC TGG (reversed) Intergenic
No off target data available for this crispr