ID: 1008307298

View in Genome Browser
Species Human (GRCh38)
Location 6:49918850-49918872
Sequence ATGAGCTGGTGGAAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008307298_1008307303 -3 Left 1008307298 6:49918850-49918872 CCATCACACTTCCACCAGCTCAT No data
Right 1008307303 6:49918870-49918892 CATCCCAGGCAAGATCAGAAGGG No data
1008307298_1008307306 3 Left 1008307298 6:49918850-49918872 CCATCACACTTCCACCAGCTCAT No data
Right 1008307306 6:49918876-49918898 AGGCAAGATCAGAAGGGAACTGG No data
1008307298_1008307302 -4 Left 1008307298 6:49918850-49918872 CCATCACACTTCCACCAGCTCAT No data
Right 1008307302 6:49918869-49918891 TCATCCCAGGCAAGATCAGAAGG No data
1008307298_1008307307 27 Left 1008307298 6:49918850-49918872 CCATCACACTTCCACCAGCTCAT No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008307298 Original CRISPR ATGAGCTGGTGGAAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr