ID: 1008307306

View in Genome Browser
Species Human (GRCh38)
Location 6:49918876-49918898
Sequence AGGCAAGATCAGAAGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008307300_1008307306 -8 Left 1008307300 6:49918861-49918883 CCACCAGCTCATCCCAGGCAAGA No data
Right 1008307306 6:49918876-49918898 AGGCAAGATCAGAAGGGAACTGG No data
1008307296_1008307306 7 Left 1008307296 6:49918846-49918868 CCTCCCATCACACTTCCACCAGC No data
Right 1008307306 6:49918876-49918898 AGGCAAGATCAGAAGGGAACTGG No data
1008307297_1008307306 4 Left 1008307297 6:49918849-49918871 CCCATCACACTTCCACCAGCTCA No data
Right 1008307306 6:49918876-49918898 AGGCAAGATCAGAAGGGAACTGG No data
1008307298_1008307306 3 Left 1008307298 6:49918850-49918872 CCATCACACTTCCACCAGCTCAT No data
Right 1008307306 6:49918876-49918898 AGGCAAGATCAGAAGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008307306 Original CRISPR AGGCAAGATCAGAAGGGAAC TGG Intergenic
No off target data available for this crispr