ID: 1008307307

View in Genome Browser
Species Human (GRCh38)
Location 6:49918900-49918922
Sequence AGCCTCTGAAATGCCTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008307298_1008307307 27 Left 1008307298 6:49918850-49918872 CCATCACACTTCCACCAGCTCAT No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data
1008307305_1008307307 3 Left 1008307305 6:49918874-49918896 CCAGGCAAGATCAGAAGGGAACT No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data
1008307301_1008307307 13 Left 1008307301 6:49918864-49918886 CCAGCTCATCCCAGGCAAGATCA No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data
1008307304_1008307307 4 Left 1008307304 6:49918873-49918895 CCCAGGCAAGATCAGAAGGGAAC No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data
1008307297_1008307307 28 Left 1008307297 6:49918849-49918871 CCCATCACACTTCCACCAGCTCA No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data
1008307300_1008307307 16 Left 1008307300 6:49918861-49918883 CCACCAGCTCATCCCAGGCAAGA No data
Right 1008307307 6:49918900-49918922 AGCCTCTGAAATGCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008307307 Original CRISPR AGCCTCTGAAATGCCTGCTC AGG Intergenic
No off target data available for this crispr