ID: 1008308463

View in Genome Browser
Species Human (GRCh38)
Location 6:49934855-49934877
Sequence GGCTCAAGAAAGCCTCTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008308459_1008308463 8 Left 1008308459 6:49934824-49934846 CCAGGAAAGATGACAGCTTCAAT No data
Right 1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG No data
1008308457_1008308463 12 Left 1008308457 6:49934820-49934842 CCCTCCAGGAAAGATGACAGCTT No data
Right 1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG No data
1008308458_1008308463 11 Left 1008308458 6:49934821-49934843 CCTCCAGGAAAGATGACAGCTTC No data
Right 1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008308463 Original CRISPR GGCTCAAGAAAGCCTCTAGC AGG Intergenic
No off target data available for this crispr