ID: 1008312619

View in Genome Browser
Species Human (GRCh38)
Location 6:49995058-49995080
Sequence AAGGCTACACAATGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008312617_1008312619 -8 Left 1008312617 6:49995043-49995065 CCTCAGTTGTAGAATAAGGCTAC No data
Right 1008312619 6:49995058-49995080 AAGGCTACACAATGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008312619 Original CRISPR AAGGCTACACAATGCTACCA GGG Intergenic
No off target data available for this crispr