ID: 1008323252

View in Genome Browser
Species Human (GRCh38)
Location 6:50144292-50144314
Sequence ATATTTCATCATAAAACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008323252_1008323255 5 Left 1008323252 6:50144292-50144314 CCTCATGTTTTATGATGAAATAT No data
Right 1008323255 6:50144320-50144342 CAATATATATATAAAACCTAGGG No data
1008323252_1008323254 4 Left 1008323252 6:50144292-50144314 CCTCATGTTTTATGATGAAATAT No data
Right 1008323254 6:50144319-50144341 CCAATATATATATAAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008323252 Original CRISPR ATATTTCATCATAAAACATG AGG (reversed) Intergenic
No off target data available for this crispr