ID: 1008325428

View in Genome Browser
Species Human (GRCh38)
Location 6:50175088-50175110
Sequence TGGGTAGAACTTCCTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008325428_1008325432 2 Left 1008325428 6:50175088-50175110 CCCAAGGAAGGAAGTTCTACCCA No data
Right 1008325432 6:50175113-50175135 TCAATAGAGATCCTGAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008325428 Original CRISPR TGGGTAGAACTTCCTTCCTT GGG (reversed) Intergenic
No off target data available for this crispr