ID: 1008329976

View in Genome Browser
Species Human (GRCh38)
Location 6:50233125-50233147
Sequence GAGCTGAACTCACACTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008329973_1008329976 15 Left 1008329973 6:50233087-50233109 CCAAAGAGTTATTTTATGGATTA No data
Right 1008329976 6:50233125-50233147 GAGCTGAACTCACACTAAGAAGG No data
1008329971_1008329976 21 Left 1008329971 6:50233081-50233103 CCTACTCCAAAGAGTTATTTTAT No data
Right 1008329976 6:50233125-50233147 GAGCTGAACTCACACTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008329976 Original CRISPR GAGCTGAACTCACACTAAGA AGG Intergenic
No off target data available for this crispr