ID: 1008335671

View in Genome Browser
Species Human (GRCh38)
Location 6:50301930-50301952
Sequence AAACCCTACAAAATAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008335671_1008335675 18 Left 1008335671 6:50301930-50301952 CCATAGGTTATTTTGTAGGGTTT No data
Right 1008335675 6:50301971-50301993 CATTTAAGTCTTTAATCCAGGGG No data
1008335671_1008335674 17 Left 1008335671 6:50301930-50301952 CCATAGGTTATTTTGTAGGGTTT No data
Right 1008335674 6:50301970-50301992 ACATTTAAGTCTTTAATCCAGGG No data
1008335671_1008335673 16 Left 1008335671 6:50301930-50301952 CCATAGGTTATTTTGTAGGGTTT No data
Right 1008335673 6:50301969-50301991 TACATTTAAGTCTTTAATCCAGG No data
1008335671_1008335672 -10 Left 1008335671 6:50301930-50301952 CCATAGGTTATTTTGTAGGGTTT No data
Right 1008335672 6:50301943-50301965 TGTAGGGTTTTTATAGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008335671 Original CRISPR AAACCCTACAAAATAACCTA TGG (reversed) Intergenic
No off target data available for this crispr