ID: 1008338086

View in Genome Browser
Species Human (GRCh38)
Location 6:50330919-50330941
Sequence AAATAGGTCTCATGTGCAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008338086_1008338088 15 Left 1008338086 6:50330919-50330941 CCGATTGCACATGAGACCTATTT No data
Right 1008338088 6:50330957-50330979 AAAAAATTCAAAGCAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008338086 Original CRISPR AAATAGGTCTCATGTGCAAT CGG (reversed) Intergenic
No off target data available for this crispr