ID: 1008338675

View in Genome Browser
Species Human (GRCh38)
Location 6:50337423-50337445
Sequence AATTGTATACAGCAATTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008338675_1008338679 20 Left 1008338675 6:50337423-50337445 CCATCCAATTGCTGTATACAATT No data
Right 1008338679 6:50337466-50337488 ATGGAAAGCCAGCAATTTTGAGG No data
1008338675_1008338681 30 Left 1008338675 6:50337423-50337445 CCATCCAATTGCTGTATACAATT No data
Right 1008338681 6:50337476-50337498 AGCAATTTTGAGGAAGAACTTGG No data
1008338675_1008338678 1 Left 1008338675 6:50337423-50337445 CCATCCAATTGCTGTATACAATT No data
Right 1008338678 6:50337447-50337469 CAAGTTCAGCTTATTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008338675 Original CRISPR AATTGTATACAGCAATTGGA TGG (reversed) Intergenic
No off target data available for this crispr