ID: 1008341043

View in Genome Browser
Species Human (GRCh38)
Location 6:50364563-50364585
Sequence GAGCTGTTCTTGGGGATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008341036_1008341043 10 Left 1008341036 6:50364530-50364552 CCAGTGACCCACTAGTAGCAAAA No data
Right 1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG No data
1008341037_1008341043 3 Left 1008341037 6:50364537-50364559 CCCACTAGTAGCAAAAAACATGC No data
Right 1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG No data
1008341038_1008341043 2 Left 1008341038 6:50364538-50364560 CCACTAGTAGCAAAAAACATGCC No data
Right 1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008341043 Original CRISPR GAGCTGTTCTTGGGGATAGA AGG Intergenic
No off target data available for this crispr