ID: 1008343508

View in Genome Browser
Species Human (GRCh38)
Location 6:50397150-50397172
Sequence ACTTTCATATAAAATAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008343508_1008343513 24 Left 1008343508 6:50397150-50397172 CCCCATCTATTTTATATGAAAGT No data
Right 1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG No data
1008343508_1008343514 25 Left 1008343508 6:50397150-50397172 CCCCATCTATTTTATATGAAAGT No data
Right 1008343514 6:50397198-50397220 AATCTCCATGATTTCTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008343508 Original CRISPR ACTTTCATATAAAATAGATG GGG (reversed) Intergenic