ID: 1008343510

View in Genome Browser
Species Human (GRCh38)
Location 6:50397152-50397174
Sequence AGACTTTCATATAAAATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008343510_1008343514 23 Left 1008343510 6:50397152-50397174 CCATCTATTTTATATGAAAGTCT No data
Right 1008343514 6:50397198-50397220 AATCTCCATGATTTCTTGATGGG No data
1008343510_1008343513 22 Left 1008343510 6:50397152-50397174 CCATCTATTTTATATGAAAGTCT No data
Right 1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008343510 Original CRISPR AGACTTTCATATAAAATAGA TGG (reversed) Intergenic