ID: 1008343513 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:50397197-50397219 |
| Sequence | TAATCTCCATGATTTCTTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008343509_1008343513 | 23 | Left | 1008343509 | 6:50397151-50397173 | CCCATCTATTTTATATGAAAGTC | No data | ||
| Right | 1008343513 | 6:50397197-50397219 | TAATCTCCATGATTTCTTGATGG | No data | ||||
| 1008343508_1008343513 | 24 | Left | 1008343508 | 6:50397150-50397172 | CCCCATCTATTTTATATGAAAGT | No data | ||
| Right | 1008343513 | 6:50397197-50397219 | TAATCTCCATGATTTCTTGATGG | No data | ||||
| 1008343510_1008343513 | 22 | Left | 1008343510 | 6:50397152-50397174 | CCATCTATTTTATATGAAAGTCT | No data | ||
| Right | 1008343513 | 6:50397197-50397219 | TAATCTCCATGATTTCTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008343513 | Original CRISPR | TAATCTCCATGATTTCTTGA TGG | Intergenic | ||