ID: 1008343513

View in Genome Browser
Species Human (GRCh38)
Location 6:50397197-50397219
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008343509_1008343513 23 Left 1008343509 6:50397151-50397173 CCCATCTATTTTATATGAAAGTC No data
Right 1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG No data
1008343508_1008343513 24 Left 1008343508 6:50397150-50397172 CCCCATCTATTTTATATGAAAGT No data
Right 1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG No data
1008343510_1008343513 22 Left 1008343510 6:50397152-50397174 CCATCTATTTTATATGAAAGTCT No data
Right 1008343513 6:50397197-50397219 TAATCTCCATGATTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008343513 Original CRISPR TAATCTCCATGATTTCTTGA TGG Intergenic