ID: 1008348748

View in Genome Browser
Species Human (GRCh38)
Location 6:50462582-50462604
Sequence CCAGTTAAGAACTGATTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008348748_1008348753 -1 Left 1008348748 6:50462582-50462604 CCTATAAATCAGTTCTTAACTGG No data
Right 1008348753 6:50462604-50462626 GGGATCAATTTTGTCCACCAGGG No data
1008348748_1008348754 8 Left 1008348748 6:50462582-50462604 CCTATAAATCAGTTCTTAACTGG No data
Right 1008348754 6:50462613-50462635 TTTGTCCACCAGGGATCACACGG No data
1008348748_1008348752 -2 Left 1008348748 6:50462582-50462604 CCTATAAATCAGTTCTTAACTGG No data
Right 1008348752 6:50462603-50462625 GGGGATCAATTTTGTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008348748 Original CRISPR CCAGTTAAGAACTGATTTAT AGG (reversed) Intergenic
No off target data available for this crispr