ID: 1008358203

View in Genome Browser
Species Human (GRCh38)
Location 6:50581179-50581201
Sequence TCTTCTATGCAGAAAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008358203_1008358204 -2 Left 1008358203 6:50581179-50581201 CCATTCACTTTCTGCATAGAAGA No data
Right 1008358204 6:50581200-50581222 GAAACCTCCGTTCTCCTGCCTGG No data
1008358203_1008358210 21 Left 1008358203 6:50581179-50581201 CCATTCACTTTCTGCATAGAAGA No data
Right 1008358210 6:50581223-50581245 AATGTTTGAAGACTGGAAGAAGG No data
1008358203_1008358208 14 Left 1008358203 6:50581179-50581201 CCATTCACTTTCTGCATAGAAGA No data
Right 1008358208 6:50581216-50581238 TGCCTGGAATGTTTGAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008358203 Original CRISPR TCTTCTATGCAGAAAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr