ID: 1008360232

View in Genome Browser
Species Human (GRCh38)
Location 6:50608792-50608814
Sequence AAGCTGTATTTACACGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008360232_1008360235 -1 Left 1008360232 6:50608792-50608814 CCCACTTCGTGTAAATACAGCTT No data
Right 1008360235 6:50608814-50608836 TTGCTTTTAAGAAACAGCAAGGG No data
1008360232_1008360234 -2 Left 1008360232 6:50608792-50608814 CCCACTTCGTGTAAATACAGCTT No data
Right 1008360234 6:50608813-50608835 TTTGCTTTTAAGAAACAGCAAGG No data
1008360232_1008360236 0 Left 1008360232 6:50608792-50608814 CCCACTTCGTGTAAATACAGCTT No data
Right 1008360236 6:50608815-50608837 TGCTTTTAAGAAACAGCAAGGGG No data
1008360232_1008360238 30 Left 1008360232 6:50608792-50608814 CCCACTTCGTGTAAATACAGCTT No data
Right 1008360238 6:50608845-50608867 CATTCTCTCATTAGAAAAACTGG No data
1008360232_1008360237 7 Left 1008360232 6:50608792-50608814 CCCACTTCGTGTAAATACAGCTT No data
Right 1008360237 6:50608822-50608844 AAGAAACAGCAAGGGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008360232 Original CRISPR AAGCTGTATTTACACGAAGT GGG (reversed) Intergenic
No off target data available for this crispr