ID: 1008360233

View in Genome Browser
Species Human (GRCh38)
Location 6:50608793-50608815
Sequence AAAGCTGTATTTACACGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008360233_1008360236 -1 Left 1008360233 6:50608793-50608815 CCACTTCGTGTAAATACAGCTTT No data
Right 1008360236 6:50608815-50608837 TGCTTTTAAGAAACAGCAAGGGG No data
1008360233_1008360235 -2 Left 1008360233 6:50608793-50608815 CCACTTCGTGTAAATACAGCTTT No data
Right 1008360235 6:50608814-50608836 TTGCTTTTAAGAAACAGCAAGGG No data
1008360233_1008360237 6 Left 1008360233 6:50608793-50608815 CCACTTCGTGTAAATACAGCTTT No data
Right 1008360237 6:50608822-50608844 AAGAAACAGCAAGGGGCATATGG No data
1008360233_1008360238 29 Left 1008360233 6:50608793-50608815 CCACTTCGTGTAAATACAGCTTT No data
Right 1008360238 6:50608845-50608867 CATTCTCTCATTAGAAAAACTGG No data
1008360233_1008360234 -3 Left 1008360233 6:50608793-50608815 CCACTTCGTGTAAATACAGCTTT No data
Right 1008360234 6:50608813-50608835 TTTGCTTTTAAGAAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008360233 Original CRISPR AAAGCTGTATTTACACGAAG TGG (reversed) Intergenic