ID: 1008360235

View in Genome Browser
Species Human (GRCh38)
Location 6:50608814-50608836
Sequence TTGCTTTTAAGAAACAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008360232_1008360235 -1 Left 1008360232 6:50608792-50608814 CCCACTTCGTGTAAATACAGCTT No data
Right 1008360235 6:50608814-50608836 TTGCTTTTAAGAAACAGCAAGGG No data
1008360233_1008360235 -2 Left 1008360233 6:50608793-50608815 CCACTTCGTGTAAATACAGCTTT No data
Right 1008360235 6:50608814-50608836 TTGCTTTTAAGAAACAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008360235 Original CRISPR TTGCTTTTAAGAAACAGCAA GGG Intergenic