ID: 1008360238 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:50608845-50608867 |
| Sequence | CATTCTCTCATTAGAAAAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008360233_1008360238 | 29 | Left | 1008360233 | 6:50608793-50608815 | CCACTTCGTGTAAATACAGCTTT | No data | ||
| Right | 1008360238 | 6:50608845-50608867 | CATTCTCTCATTAGAAAAACTGG | No data | ||||
| 1008360232_1008360238 | 30 | Left | 1008360232 | 6:50608792-50608814 | CCCACTTCGTGTAAATACAGCTT | No data | ||
| Right | 1008360238 | 6:50608845-50608867 | CATTCTCTCATTAGAAAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008360238 | Original CRISPR | CATTCTCTCATTAGAAAAAC TGG | Intergenic | ||