ID: 1008362587

View in Genome Browser
Species Human (GRCh38)
Location 6:50638991-50639013
Sequence CTATTTTGCCACCATTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008362587_1008362590 24 Left 1008362587 6:50638991-50639013 CCAATGGAATGGTGGCAAAATAG No data
Right 1008362590 6:50639038-50639060 TATTAATAAATGTGAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008362587 Original CRISPR CTATTTTGCCACCATTCCAT TGG (reversed) Intergenic
No off target data available for this crispr