ID: 1008362775

View in Genome Browser
Species Human (GRCh38)
Location 6:50641441-50641463
Sequence TGTCCACTGCTGTAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008362775_1008362779 15 Left 1008362775 6:50641441-50641463 CCACCCACCTACAGCAGTGGACA No data
Right 1008362779 6:50641479-50641501 TCTACGTGATCTCATACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008362775 Original CRISPR TGTCCACTGCTGTAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr