ID: 1008364606

View in Genome Browser
Species Human (GRCh38)
Location 6:50662825-50662847
Sequence ATCTGATGCTCTGAATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008364606_1008364608 -5 Left 1008364606 6:50662825-50662847 CCAAAATATTCAGAGCATCAGAT No data
Right 1008364608 6:50662843-50662865 CAGATTAGCTAACAACATATGGG No data
1008364606_1008364612 28 Left 1008364606 6:50662825-50662847 CCAAAATATTCAGAGCATCAGAT No data
Right 1008364612 6:50662876-50662898 GAGAGCACCCATCAGGGTTTTGG No data
1008364606_1008364611 22 Left 1008364606 6:50662825-50662847 CCAAAATATTCAGAGCATCAGAT No data
Right 1008364611 6:50662870-50662892 AGATAAGAGAGCACCCATCAGGG No data
1008364606_1008364610 21 Left 1008364606 6:50662825-50662847 CCAAAATATTCAGAGCATCAGAT No data
Right 1008364610 6:50662869-50662891 GAGATAAGAGAGCACCCATCAGG No data
1008364606_1008364607 -6 Left 1008364606 6:50662825-50662847 CCAAAATATTCAGAGCATCAGAT No data
Right 1008364607 6:50662842-50662864 TCAGATTAGCTAACAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008364606 Original CRISPR ATCTGATGCTCTGAATATTT TGG (reversed) Intergenic
No off target data available for this crispr