ID: 1008369882

View in Genome Browser
Species Human (GRCh38)
Location 6:50720051-50720073
Sequence GAGCAGCACACAAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008369875_1008369882 21 Left 1008369875 6:50720007-50720029 CCCAAAGCCTCTGAAGTTTATTT 0: 1
1: 0
2: 1
3: 42
4: 367
Right 1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG No data
1008369877_1008369882 14 Left 1008369877 6:50720014-50720036 CCTCTGAAGTTTATTTTTCTAGC 0: 1
1: 0
2: 3
3: 30
4: 350
Right 1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG No data
1008369876_1008369882 20 Left 1008369876 6:50720008-50720030 CCAAAGCCTCTGAAGTTTATTTT 0: 1
1: 0
2: 2
3: 39
4: 429
Right 1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008369882 Original CRISPR GAGCAGCACACAAGGCAAGA GGG Intronic
No off target data available for this crispr