ID: 1008370068

View in Genome Browser
Species Human (GRCh38)
Location 6:50721890-50721912
Sequence ATGATGTTCTTGAAGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008370064_1008370068 -10 Left 1008370064 6:50721877-50721899 CCAAAGACCCCAAATGATGTTCT 0: 1
1: 0
2: 0
3: 20
4: 192
Right 1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG No data
1008370063_1008370068 -4 Left 1008370063 6:50721871-50721893 CCACTTCCAAAGACCCCAAATGA 0: 1
1: 0
2: 2
3: 18
4: 180
Right 1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008370068 Original CRISPR ATGATGTTCTTGAAGAAATA TGG Intronic
No off target data available for this crispr