ID: 1008370462

View in Genome Browser
Species Human (GRCh38)
Location 6:50724738-50724760
Sequence GCCACCGTCTGTGCTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008370462_1008370469 6 Left 1008370462 6:50724738-50724760 CCAGTTGCAGCACAGACGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1008370469 6:50724767-50724789 TGTGTGTGTGTGTGTCGGCGGGG No data
1008370462_1008370471 8 Left 1008370462 6:50724738-50724760 CCAGTTGCAGCACAGACGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1008370471 6:50724769-50724791 TGTGTGTGTGTGTCGGCGGGGGG 0: 4
1: 29
2: 445
3: 1866
4: 10457
1008370462_1008370466 1 Left 1008370462 6:50724738-50724760 CCAGTTGCAGCACAGACGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1008370466 6:50724762-50724784 GGGTGTGTGTGTGTGTGTGTCGG 0: 44
1: 2525
2: 4371
3: 8508
4: 15094
1008370462_1008370467 4 Left 1008370462 6:50724738-50724760 CCAGTTGCAGCACAGACGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1008370467 6:50724765-50724787 TGTGTGTGTGTGTGTGTCGGCGG 0: 35
1: 882
2: 6870
3: 10939
4: 14765
1008370462_1008370468 5 Left 1008370462 6:50724738-50724760 CCAGTTGCAGCACAGACGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1008370468 6:50724766-50724788 GTGTGTGTGTGTGTGTCGGCGGG 0: 4
1: 96
2: 1330
3: 7588
4: 12300
1008370462_1008370470 7 Left 1008370462 6:50724738-50724760 CCAGTTGCAGCACAGACGGTGGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1008370470 6:50724768-50724790 GTGTGTGTGTGTGTCGGCGGGGG 0: 5
1: 34
2: 488
3: 2590
4: 11275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008370462 Original CRISPR GCCACCGTCTGTGCTGCAAC TGG (reversed) Intronic
900122505 1:1054805-1054827 CCCACTGTCTGTGCTGCAGGGGG + Exonic
900645434 1:3706753-3706775 GCCACCGTCTGTGGCGCCCCGGG - Intronic
900929096 1:5725127-5725149 GCCACCATCTGTGCTGCTCATGG - Intergenic
902360496 1:15939994-15940016 GCCACCGTCTTTGATTCACCGGG + Exonic
902805657 1:18859761-18859783 GCCACCGACTGTGGGGCACCTGG + Intronic
912121188 1:106473808-106473830 GCCACACTCTGTGCTGGCACTGG - Intergenic
920232076 1:204477439-204477461 GCCAGGGTCTGAGCTGCACCAGG + Intronic
920932304 1:210400458-210400480 TCCAGGGTCTGTGCTGCAAATGG - Exonic
1069915663 10:71785180-71785202 GCCACCATCTGGGCTCCACCGGG + Intronic
1076767444 10:132644315-132644337 GGCTCCGTCTGTGCTGCAGGTGG - Intronic
1077359232 11:2133361-2133383 GCCAGCGTCTGAGCTGCTCCCGG + Intronic
1083535950 11:63466798-63466820 GCCTCCCTCTGGGCTGCCACAGG + Intronic
1089032314 11:115345059-115345081 AGCACCATCTGGGCTGCAACAGG + Intronic
1089273033 11:117315031-117315053 CCCACCATCTGGGCTGCCACTGG - Intronic
1089864321 11:121618382-121618404 GCCCACGTCTGTGCTGCCAATGG + Intronic
1096427472 12:51516327-51516349 GCCACAGGCTGTGCTGGCACTGG - Intergenic
1097573183 12:61357237-61357259 GCCACCGTGCCTGCTGCAGCAGG - Intergenic
1100026017 12:90128910-90128932 GCCATTTTCTGTGTTGCAACAGG + Intergenic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1107851094 13:44574348-44574370 GCCACTATGAGTGCTGCAACTGG - Exonic
1108141876 13:47432069-47432091 GCCTCCTGCTGTGATGCAACAGG + Intergenic
1113965663 13:114152047-114152069 GGCATCGTCTGTGCTGAAGCAGG + Intergenic
1114856266 14:26448349-26448371 ACCACCAGCTGTGCTGCCACTGG + Exonic
1118186523 14:63543063-63543085 GCCACCGGCGGAGCCGCAACGGG - Exonic
1118318749 14:64741299-64741321 GCCACCCTCTGTGCTGGACCAGG + Exonic
1122060819 14:99135631-99135653 ACCACGGTCTGTGCAGCACCCGG - Intergenic
1123119283 14:105909379-105909401 CCCAAAGTCTGTGCTGCACCAGG + Intergenic
1125874354 15:43131080-43131102 GCCACTGCCTGTGCCGCACCTGG - Intronic
1128968549 15:72086121-72086143 GCACCCCTCTGTGCTGCCACTGG - Intronic
1130988366 15:88859469-88859491 GCCTCCTTCTGTGCTGCAGTAGG - Intronic
1131117703 15:89804837-89804859 GCCACCGTCTGTCTGGTAACCGG + Intronic
1131295305 15:91143031-91143053 GCCACTGGCTGTGCTGTCACAGG - Intronic
1132994978 16:2818105-2818127 GCCCCAGGCTGTGCTGCAGCCGG + Intronic
1134025708 16:10951541-10951563 GGCACCTCCTGTGCTGCACCAGG + Intronic
1135205066 16:20476677-20476699 GCCACCCACTGTGCTGGAAAGGG - Intronic
1135213832 16:20547136-20547158 GCCACCCACTGTGCTGGAAAGGG + Intronic
1137567121 16:49540234-49540256 GCCACAGTCTTTGCTGTGACTGG - Intronic
1142418601 16:89956847-89956869 GCCACAGGCTGAGCTGCAAGGGG + Intronic
1147197746 17:38778936-38778958 CCTTCCCTCTGTGCTGCAACTGG - Intronic
1149567785 17:57652122-57652144 GCCACCGCCGCTGCTGCCACTGG - Exonic
1150633758 17:66898485-66898507 GCCACATTCTGGGCTGGAACTGG + Intergenic
1160519658 18:79497401-79497423 TCCACGGTCTGTGCTGTCACCGG - Intronic
1164676069 19:30102413-30102435 GCCGCCCTCTGTCCTGAAACAGG + Intergenic
1165080133 19:33302153-33302175 GCTGCCGGCTGTGCTGGAACAGG + Exonic
1168124754 19:54277266-54277288 GTCACCGTCTCTGCTGCAGGTGG + Intronic
1168132785 19:54331893-54331915 GTCACCGTCTCTGCTGCAGGTGG + Intergenic
1168177233 19:54634282-54634304 GTCACCGTCTCTGCTGCAGGTGG - Intronic
1168181539 19:54665441-54665463 GTCACCGTCTCTGCTGCAGGTGG - Intronic
929930362 2:46250925-46250947 GGCACCGTGTGTGCTGCAGCTGG - Intergenic
930033659 2:47072736-47072758 GCCACCCTCAGGGCTGAAACAGG + Intronic
930879121 2:56251850-56251872 GCCACCTTCTCTCCTGCTACGGG - Intronic
933740984 2:85533714-85533736 GTCACTGTCTGTGCAGCTACCGG + Intergenic
934925256 2:98377708-98377730 GACATCGTCAGTGCTGCAGCCGG + Exonic
944667334 2:201968693-201968715 GACACCGTCTGCTCTGCACCGGG - Intergenic
946023230 2:216656222-216656244 GCCACTGTCTGTGGTACAAGAGG + Intronic
946482928 2:220074108-220074130 GCCACCCTCTCTGCTGCCACTGG + Intergenic
1168877719 20:1182674-1182696 GACACTCTCTGTGCTGCAAGAGG + Intronic
1172991273 20:39038754-39038776 GCATCCTTCTGTGCTGCAGCGGG + Exonic
1174465470 20:50713847-50713869 GGCACTGTCTGAGCTGCAAGTGG - Intergenic
1175690791 20:61064781-61064803 GCCAGGGTGAGTGCTGCAACTGG + Intergenic
1176059270 20:63165181-63165203 GCCACGGGATGGGCTGCAACAGG - Intergenic
1176349102 21:5776097-5776119 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1176355916 21:5896681-5896703 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1176543423 21:8174167-8174189 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1176562374 21:8357212-8357234 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1179724406 21:43333796-43333818 GCCGCCGTCTGTGCTCCACGCGG - Intergenic
1180650033 22:17369758-17369780 GCCGCCGCCTGTGCCGCAGCGGG + Exonic
1184880897 22:47303609-47303631 GGCACTGTCTCTGCTGCACCAGG - Intergenic
1203248290 22_KI270733v1_random:90386-90408 GCCACCCTGTGTGTTTCAACTGG - Intergenic
965507292 3:169530548-169530570 GCCACCCTCAGAGCTGCACCAGG + Intronic
965783506 3:172312892-172312914 GCCACAGCCTCTGCTGAAACAGG + Intronic
969528706 4:7717696-7717718 GCCACCGTTAGTGCTGCAGAGGG - Intronic
971304041 4:25464857-25464879 GCGACCTTCTGTCCTGCAGCAGG + Intergenic
974192418 4:58523173-58523195 GCCACCTTCTCTGCTGGAAAAGG - Intergenic
979412637 4:120397265-120397287 GCCATGGTCTGTTCTGCCACAGG - Intergenic
985484907 5:143065-143087 GCCGCCGTCTGTGCTGACACAGG - Exonic
987964148 5:24850626-24850648 GCCACAGTCTCTGCAGCAACCGG + Intergenic
996715813 5:126587205-126587227 GCTACATTCTGTGCTGAAACTGG + Intronic
997349745 5:133222143-133222165 TCCAGCGTCTGTGCTGAGACAGG + Intronic
997419117 5:133751964-133751986 TCCACCGTCTCTGCTGCTAATGG + Intergenic
998155945 5:139787336-139787358 CCCTTCGTCTGTGCTGGAACTGG - Intergenic
998385688 5:141756037-141756059 ACCACCGTCTGTACTGGGACAGG + Intergenic
999712355 5:154329762-154329784 CCCACCCTCTGTGCTTCATCTGG + Intronic
1002076677 5:176712608-176712630 TCCATCGGCTGTGCTGCCACTGG - Intergenic
1002934668 6:1661542-1661564 GCCTCCGTGTGTGCTGGATCAGG - Intronic
1008078123 6:47167226-47167248 GCCACCCACTCTGCTGCAGCTGG + Intergenic
1008370462 6:50724738-50724760 GCCACCGTCTGTGCTGCAACTGG - Intronic
1013184611 6:107746776-107746798 GCCATCGGCGGTGCTGCAGCAGG - Exonic
1017882142 6:158569363-158569385 ATAACCGCCTGTGCTGCAACAGG - Intronic
1020125433 7:5530424-5530446 GCCGCCGTCTGGGCCGCAGCGGG - Intronic
1023659965 7:42461048-42461070 GCCAACATCTCTGCTGCTACAGG - Intergenic
1026628802 7:72019712-72019734 GCCAGCATCTTGGCTGCAACTGG + Intronic
1029528765 7:101111604-101111626 GCCACCCTCTGTGGTACTACAGG - Intergenic
1034267564 7:149788625-149788647 GCCGGGGTCTGTGCTGCAAAAGG + Intergenic
1034408363 7:150921773-150921795 GCCTCTGTCTCTGCTGCCACAGG + Intergenic
1035022380 7:155807225-155807247 GCCCCGGCCTGTGCTGCAAGTGG - Intronic
1035064888 7:156097170-156097192 GCCACCGTCTGTGGGGCTGCGGG - Intergenic
1036122649 8:6035153-6035175 TCCACCGTCTGCTCTGCAAGAGG - Intergenic
1041641394 8:60206745-60206767 GGCACTCTCTGTGCTGCAATGGG - Intronic
1049288135 8:141787635-141787657 GCCACCCTCGCTGCTGCAATGGG + Intergenic
1049324366 8:142014441-142014463 GCCAGGGTCTGAGCAGCAACAGG - Intergenic
1052804694 9:33002370-33002392 GCCAGGGTCTGTGCTAAAACTGG - Intronic
1056315647 9:85387234-85387256 GCCACCATCTGTGCACCAATGGG + Intergenic
1059230584 9:112717902-112717924 GCCGCCGTCTTTGTTGCTACAGG - Intronic
1060480455 9:124014115-124014137 GCTACCGTCCTTGCTGAAACAGG - Exonic
1203464693 Un_GL000220v1:73637-73659 GCCACCCTGTGTGTTTCAACTGG - Intergenic
1191726107 X:64282997-64283019 CCCACCGACTGAGCTGAAACAGG + Intronic
1197242684 X:124136784-124136806 ACCACCGTCTGCTCGGCAACGGG - Intronic
1198129709 X:133681563-133681585 GCCACTTTCTTTGCTGCTACTGG - Intronic