ID: 1008371121

View in Genome Browser
Species Human (GRCh38)
Location 6:50731842-50731864
Sequence GGCCCCTGGAACTCTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008371118_1008371121 -2 Left 1008371118 6:50731821-50731843 CCATGTTCTGAATTAGATCATGG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG 0: 1
1: 0
2: 1
3: 25
4: 249
1008371115_1008371121 18 Left 1008371115 6:50731801-50731823 CCTTTCCAGCCAGCAAGATGCCA 0: 1
1: 2
2: 5
3: 31
4: 276
Right 1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG 0: 1
1: 0
2: 1
3: 25
4: 249
1008371116_1008371121 13 Left 1008371116 6:50731806-50731828 CCAGCCAGCAAGATGCCATGTTC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG 0: 1
1: 0
2: 1
3: 25
4: 249
1008371117_1008371121 9 Left 1008371117 6:50731810-50731832 CCAGCAAGATGCCATGTTCTGAA 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG 0: 1
1: 0
2: 1
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008371121 Original CRISPR GGCCCCTGGAACTCTGCAGA TGG Intronic
900496451 1:2978141-2978163 GGCCCCTGGCTCTCTGCTGCTGG - Intergenic
900955790 1:5885554-5885576 GGGCCCTGGGACTCTGATGATGG - Intronic
901511529 1:9720300-9720322 TGCTCCTGGAGCTCTTCAGAGGG + Intronic
902187820 1:14738669-14738691 GGCCCCGGGAACTGTGTACAAGG + Intronic
903672520 1:25045153-25045175 GGTCCCTGGACCTCTGGGGAAGG + Intergenic
904767906 1:32864471-32864493 GGCCCCTGGCACCCTGCAAAAGG + Intronic
906211198 1:44013190-44013212 GGAACCTGGATCTCTGCAAAGGG - Intronic
906675801 1:47693036-47693058 GGCCCCTGCAGAGCTGCAGATGG - Intergenic
907457715 1:54586061-54586083 GCCCCCAGAAACACTGCAGAGGG - Intronic
907716136 1:56927983-56928005 GGCCCCTGCAATTCAGCTGATGG - Intergenic
909389211 1:75099222-75099244 GGCTCCTTGAACTTTGCTGAAGG - Intergenic
911522283 1:98943277-98943299 GGACCCTGAAACTCTGTAGGAGG + Intronic
912557523 1:110527030-110527052 GACACCCAGAACTCTGCAGAAGG - Intergenic
912693337 1:111821208-111821230 GCCCCTAGGACCTCTGCAGATGG - Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
918600319 1:186350766-186350788 GTACCCTGGAGCTCTACAGAGGG + Intronic
920980401 1:210829073-210829095 GGCCCCTGCATCTCTCCTGAGGG + Intronic
922507217 1:226133535-226133557 GGTCCCTGGACCTCTGAGGAGGG + Intergenic
923145235 1:231193050-231193072 GGCCCCTGGTACTGGGCAGATGG + Intronic
1064110866 10:12537678-12537700 TGCCCCTGGAATTGTGCACATGG + Intronic
1065173439 10:23054265-23054287 GGCCAGTACAACTCTGCAGAAGG + Intergenic
1066649194 10:37639338-37639360 TGCCCTGGGGACTCTGCAGAGGG + Intergenic
1067015576 10:42754755-42754777 GGGCCCTGGAACTCACCAGGCGG - Intergenic
1067892647 10:50149912-50149934 GGCCCCTTGAGCTTTGGAGAAGG - Intergenic
1069952144 10:72026438-72026460 GGCTCCTGCAAAGCTGCAGAGGG - Intergenic
1071242207 10:83719805-83719827 AGTCCCTGGAACTGGGCAGAGGG - Intergenic
1071450059 10:85785634-85785656 GGTCCCTGGAACACTGAAAAAGG - Intronic
1072694960 10:97596312-97596334 GGCCCCTGGAACTGACCAGCAGG + Intronic
1072754823 10:98012335-98012357 GACACTTGGAACGCTGCAGATGG + Intronic
1072781945 10:98257449-98257471 GGCCACAGGGGCTCTGCAGATGG - Intronic
1073891419 10:108106742-108106764 GGATCCTGGAACTCTGGAAATGG - Intergenic
1074972186 10:118548229-118548251 GGCCCCTGGGGCTCTGATGATGG - Intergenic
1076154013 10:128188938-128188960 CGCCCCCAGAGCTCTGCAGAAGG + Intergenic
1076412529 10:130262210-130262232 GGGCCCAGGAACTCCCCAGAAGG - Intergenic
1077096806 11:802456-802478 GGACCCAGGAACTCTGGAGAAGG + Intronic
1077402084 11:2363943-2363965 GACCCCTGGGGCACTGCAGAGGG + Intergenic
1079178896 11:18171135-18171157 GGTCCCTGGAACCCTGCATGAGG - Intronic
1079376141 11:19893692-19893714 GGCACTGGGAACTCTGCAAATGG + Intronic
1083776270 11:64895620-64895642 GGCACCTGCCACTCTGCTGAGGG + Intronic
1084319241 11:68364180-68364202 GCCCCCATGAGCTCTGCAGAGGG - Intronic
1085404774 11:76255282-76255304 GTCCCCTGGTACTCTGGATAGGG + Intergenic
1085467922 11:76736852-76736874 CTGCCCTGGAACTCTGCACAGGG - Intergenic
1087291464 11:96325238-96325260 GGCTCCTGGACCTATGCAGGAGG - Intronic
1089754692 11:120678089-120678111 GGCCTCGGGGTCTCTGCAGAGGG - Intronic
1090174403 11:124635425-124635447 ACCCCTTGGAACTCTACAGAGGG + Exonic
1090758258 11:129814090-129814112 GGGACCAGGAACTCTTCAGAGGG - Intergenic
1091850610 12:3693960-3693982 GGCCCCTGGAACCCAGCAGGAGG - Intronic
1092545552 12:9448508-9448530 GGCCTCTGGAGATCTGCAGCTGG + Intergenic
1093214576 12:16348012-16348034 GGTCCCTTGAACTCTGGGGAAGG + Intronic
1094507402 12:31073543-31073565 GGCCTCTGGAGGTCTGCAGCTGG - Intergenic
1096690124 12:53315374-53315396 GGGCCCTGGCACTCTGTCGATGG - Exonic
1097013103 12:55966947-55966969 GGGCCTGGGAACCCTGCAGAAGG - Exonic
1097056566 12:56253589-56253611 GGCCCTTGGAACTCTGACCAAGG - Intronic
1097194031 12:57233985-57234007 GGCCCCTGGAACGAGGCACAAGG - Exonic
1098878558 12:75892511-75892533 GTCCTCAGGAACTCAGCAGAGGG + Intergenic
1098962669 12:76755107-76755129 GTGCCCTGGAACATTGCAGACGG + Intergenic
1100434664 12:94560773-94560795 GGACCCTAGCCCTCTGCAGAAGG + Intergenic
1101057250 12:100930919-100930941 GGCCCCTGAAACTCCTCAAAAGG + Intronic
1101986601 12:109451904-109451926 GGCCCCTGGGATTCTGCTGAAGG + Intronic
1102027171 12:109720197-109720219 GGCCCCTGCTATTGTGCAGAGGG + Intronic
1103055409 12:117816270-117816292 GCCACCTGGAGTTCTGCAGACGG + Intronic
1103115794 12:118330485-118330507 GGCCTCAGGCACTCTCCAGATGG + Intronic
1103244665 12:119446386-119446408 GCCCCCTGGAATTGTGCAAAAGG - Intronic
1103736674 12:123065092-123065114 GGCCCCTGGACGGCTGCACAAGG + Intronic
1104860235 12:131919691-131919713 GGCCTCTGCACCTCTGCACAGGG - Intronic
1104937472 12:132374269-132374291 CGCACTTGGCACTCTGCAGAGGG - Intergenic
1107555140 13:41510716-41510738 GAACTCTGGAAGTCTGCAGAGGG + Intergenic
1111426794 13:88095308-88095330 GGCCCCTGAAAATCTGTAGTAGG + Intergenic
1111942741 13:94630248-94630270 TGCCCCTGGAGCTGTGCAGAAGG - Exonic
1113074466 13:106454386-106454408 GGCCTTTATAACTCTGCAGAGGG + Intergenic
1113670240 13:112171138-112171160 GACCCCTGCACCGCTGCAGAAGG - Intergenic
1113994371 14:16053945-16053967 GGCACCTGGAAGCCCGCAGAGGG - Intergenic
1120830984 14:88997033-88997055 GGCACCTGGAGGTCTGCAGAGGG - Intergenic
1121103776 14:91267616-91267638 GGGCCCTGGAACTCAGGAGGGGG + Intergenic
1122037351 14:98958357-98958379 AGCCCCTGGAGCTCAGCAGCAGG - Intergenic
1122153298 14:99736046-99736068 GACCCCTGTAACTCTTCAGCCGG + Intergenic
1122251746 14:100444653-100444675 GGCCCCTGGGACTATACAGAGGG + Intronic
1122448679 14:101785658-101785680 GGCGACAGGGACTCTGCAGATGG - Intronic
1122791581 14:104186090-104186112 GGCCACAGGGACTCTGCAGAGGG - Intergenic
1124891300 15:33735873-33735895 GGTCCCCTGAACTCTGCAGAGGG - Intronic
1126215321 15:46147065-46147087 GGCCCCTGGGAGGCTGCAGATGG - Intergenic
1128456043 15:67832020-67832042 GGCTCCAGGAACTATGCAGCTGG - Intronic
1129462378 15:75706071-75706093 GGCCCCAGCAACTGTGCACAGGG + Intronic
1130638024 15:85643745-85643767 TGCCCCTGGAACAGTACAGAGGG + Intronic
1131265670 15:90913763-90913785 GGGCCCAGGAGTTCTGCAGAGGG + Intronic
1131351086 15:91700357-91700379 GGCCCCTGGAGCTGTGCAATTGG + Intergenic
1131471782 15:92704007-92704029 GGCCCCTGGTTCACTGCAGTTGG - Intronic
1133478814 16:6149516-6149538 GGCCCCAGAAATTCTGCAGCTGG + Intronic
1135999863 16:27284128-27284150 GCAGCCTTGAACTCTGCAGATGG - Intronic
1135999879 16:27284212-27284234 GCAGCCTTGAACTCTGCAGATGG - Intronic
1136015978 16:27401615-27401637 GCTCCCTGGAGCTCTGCAGCAGG + Intergenic
1136024875 16:27462871-27462893 TGTGCCTGGAACTCTGCACATGG - Intronic
1136710743 16:32234585-32234607 GGGCCCTGAAGCTCTGCAGGGGG + Intergenic
1136757168 16:32694826-32694848 GGGCCCTGAAGCTCTGCAGGGGG - Intergenic
1136810941 16:33175549-33175571 GGGCCCTGAAGCTCTGCAGGGGG + Intergenic
1136817417 16:33285629-33285651 GGGCCCTGAAGCTCTGCAGGGGG + Intronic
1136823981 16:33342158-33342180 GGGCCCTGAAGCTCTGCAGGGGG + Intergenic
1136995862 16:35187763-35187785 AGGCCCTGGAGCTATGCAGAAGG + Intergenic
1136999563 16:35216994-35217016 GGGCCCTGGAGCTGTGCAGGAGG + Intergenic
1137001390 16:35233578-35233600 GTGCCCTGGAGCTCTGCAGGAGG - Intergenic
1137003388 16:35251012-35251034 GGGCCCTGGAGCTGTGCAGGAGG - Intergenic
1137547155 16:49412082-49412104 GCCCACTGCAACTCTGCAAAAGG + Intergenic
1137574126 16:49587212-49587234 GGGCTCAGGAGCTCTGCAGAGGG - Intronic
1138340927 16:56288711-56288733 GTCCCCTGGAACTCAGCAGCAGG + Intronic
1141068416 16:80932348-80932370 AGAGCCTGGAAATCTGCAGAGGG - Intergenic
1141533888 16:84665722-84665744 GGCCCCTGGACCTCAGAGGATGG - Intronic
1141627655 16:85269743-85269765 TGCACCTGGCACTCTGCAGCAGG + Intergenic
1141958820 16:87391598-87391620 GGCGCCTGGAACTCTCCTGGTGG - Intronic
1142234930 16:88917598-88917620 ATCACCTTGAACTCTGCAGAGGG + Intronic
1203059317 16_KI270728v1_random:955177-955199 GGGCCCTGAAGCTCTGCAGGGGG - Intergenic
1142695262 17:1629520-1629542 GGCCCTTGGAAATCTGCAAGGGG + Intergenic
1142811579 17:2397936-2397958 GGCCCCTGGGTCACTGCAGAGGG - Intronic
1145037413 17:19551102-19551124 GGCCCCAGGCACACTCCAGATGG - Intronic
1145783168 17:27577395-27577417 GGCCCCTGCCACTCAGCAGGAGG + Intronic
1147757535 17:42778947-42778969 AGCCCGTGGAACTCTGAACAGGG - Exonic
1148492283 17:48031005-48031027 GGCCTCTGGAACTATTCACATGG + Intronic
1151295503 17:73183108-73183130 GGACCCTGGAGCAGTGCAGATGG - Intergenic
1152558249 17:81065309-81065331 GGACCCTGGACCCCTGCAGGGGG - Intronic
1152759163 17:82099131-82099153 GGCCGCTGGAGCTCGGCGGAGGG + Intergenic
1153475601 18:5495302-5495324 GGCCACTGTAAATCTGCAAAGGG + Intronic
1157223022 18:45840558-45840580 CCCCCCTGGCACTCTGCTGAAGG + Intronic
1157936427 18:51877863-51877885 GACTACTGCAACTCTGCAGAAGG + Intergenic
1158637462 18:59173829-59173851 GAGCTCTGGAAATCTGCAGAGGG - Intergenic
1159030192 18:63223068-63223090 GACCTCTGGAACTGTGCGGAAGG + Intronic
1159045588 18:63366741-63366763 GGCCCCGGGAACCCTGCGGCCGG + Intronic
1159057140 18:63477246-63477268 AGCACCAGGAACACTGCAGAGGG + Intronic
1159776111 18:72604761-72604783 GGGCCTTAGAACTCTGCAGAGGG - Intronic
1160413950 18:78694599-78694621 TGCCACTGGTACCCTGCAGAGGG + Intergenic
1160856236 19:1219157-1219179 GGCCCCTGGGCCTTTTCAGAGGG + Intronic
1161034439 19:2076658-2076680 GGCCCCGGGGACCCTGCTGATGG - Intronic
1161588262 19:5117255-5117277 TGCCCCTGGAAGGCTGCAGCAGG + Intronic
1162127365 19:8506677-8506699 GGCCCCCGGGACCCTGGAGAGGG + Intergenic
1162925117 19:13926968-13926990 TGCTCCTTGAACTCTGCAGGAGG - Exonic
1163612455 19:18308516-18308538 GGCCCCTGGCACCCAGCACATGG - Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1165153630 19:33774774-33774796 GGACCCTGGAACATTGCAAAGGG + Intergenic
1166124446 19:40705359-40705381 GGCCCCTCGAACTGTACATAAGG + Exonic
1166712907 19:44948691-44948713 GTCCCCTGGACCTCTGCAGGGGG - Exonic
1167032119 19:46969624-46969646 TGCCCCTAGACCTCTGCAGGAGG - Intronic
1168429703 19:56268376-56268398 TGCCCCAGGAACTGTACAGAGGG + Intronic
925825727 2:7846803-7846825 GGCCCCATGATCCCTGCAGAAGG + Intergenic
926036448 2:9639655-9639677 GGCCCCTGGAATTCAGGAAAGGG - Intergenic
926703885 2:15822835-15822857 GACCCCAGGAACTCCTCAGAAGG - Intergenic
926783678 2:16499200-16499222 GGCCCCTGGAGTTCTGCTTAGGG - Intergenic
926962795 2:18377106-18377128 GGCAAAAGGAACTCTGCAGAAGG - Intergenic
929021316 2:37556115-37556137 GGCACCTGAAACTGTGAAGAAGG - Intergenic
929436980 2:41936354-41936376 GGCCTCAAGAAGTCTGCAGAGGG + Exonic
929557908 2:42936939-42936961 GGCCCAGGGGACTCTGCTGAGGG - Intergenic
929785696 2:44989464-44989486 CACCCCTAGCACTCTGCAGAAGG + Intergenic
929827808 2:45323129-45323151 GAGCCATGGAACTCAGCAGAAGG - Intergenic
932108276 2:68969210-68969232 GGCCCCTGCAACTCAGCATCTGG + Intergenic
935049481 2:99512249-99512271 GGCCCTTTGAACACTCCAGATGG - Intergenic
938424964 2:131178993-131179015 GGTCCCTGGAGCTCTGCACTTGG - Intronic
938755179 2:134372867-134372889 GGCCCTTGGTGCTCAGCAGAGGG + Intronic
941635009 2:167927031-167927053 CTGCCCTGGGACTCTGCAGAGGG - Intergenic
942179851 2:173370162-173370184 GGCCTGTGGAGCTCTGCAGTGGG - Intergenic
945699216 2:213150332-213150354 CTCCCCTTGAACTCTGCAGGGGG - Intronic
948297775 2:236875725-236875747 GGCTCCTGGAAAGCTGCATAGGG - Intergenic
948592534 2:239060526-239060548 GGACCCTGGAGCCCTGCAGAGGG + Intronic
948618084 2:239214421-239214443 GGCCAAAGGAGCTCTGCAGATGG - Intronic
948798809 2:240420805-240420827 GGCCCCACGCCCTCTGCAGATGG + Intergenic
1170935812 20:20808210-20808232 GGTCCCTGAAAGTCTTCAGAGGG + Intergenic
1171243054 20:23586904-23586926 GGCCCCTTGCAGGCTGCAGAGGG + Intergenic
1172702403 20:36861775-36861797 GGCACCTGGAAGCGTGCAGATGG + Intronic
1173672596 20:44809328-44809350 GGGCCCTGGGACCCGGCAGAAGG - Intronic
1173785021 20:45786673-45786695 GGTCACTGGGACTCTGCAAAAGG + Intronic
1175698767 20:61122447-61122469 GGCAACAGGAACTCTGCAGGTGG - Intergenic
1175824939 20:61931677-61931699 TGCTCCTGGAGCTTTGCAGATGG + Intronic
1176298051 21:5084877-5084899 GGCCCCAGGAGGACTGCAGATGG + Intergenic
1178273644 21:31216734-31216756 AGCCCCTGGACCTGAGCAGAAGG + Intronic
1179538478 21:42068025-42068047 GGCCCGGAGAACTCTCCAGAAGG + Intronic
1179858978 21:44177072-44177094 GGCCCCAGGAGGACTGCAGATGG - Intergenic
1180097801 21:45567890-45567912 GCCACCTGGGACTCTCCAGAGGG - Intergenic
1180312898 22:11253570-11253592 GGCACCTGGAAGCCCGCAGAGGG + Intergenic
1180466123 22:15613142-15613164 GGTCCCTGGAGCTCTGCACTTGG - Intergenic
1180950688 22:19719190-19719212 GCCCCCTGGCACTCTCCGGAGGG + Intronic
1181602152 22:23959069-23959091 GACCCCTGGAACCCTGCATGGGG + Intronic
1181606358 22:23982238-23982260 GACCCCTGGAACCCTGCATGGGG - Intronic
1181727209 22:24819989-24820011 GGCCCCTGGGTCTGTGGAGATGG + Intronic
1182759003 22:32706897-32706919 GGCCCCTGGAATTCCCTAGAGGG + Intronic
1184250761 22:43258843-43258865 GGCCCCTGGGACTCTGAGGGGGG - Intronic
1185149336 22:49155118-49155140 TGTCCCAGGAGCTCTGCAGACGG - Intergenic
952421163 3:33132427-33132449 GGCCCCAGGCTCTCTGAAGAAGG + Intronic
954401425 3:50321604-50321626 AGCCCCAGGTCCTCTGCAGAGGG + Exonic
954753850 3:52828394-52828416 GGCCTCTGGAAAACTGCAGTGGG - Intronic
954761784 3:52879929-52879951 AGCCTCTGGAATTCTGGAGACGG + Intronic
955495938 3:59532311-59532333 GGCCCCTGAAAGACTCCAGAGGG - Intergenic
956738673 3:72258461-72258483 AGCTGCTGGAACCCTGCAGATGG - Intergenic
957478210 3:80755028-80755050 GGCTCCTGGACCTCTTCACAGGG - Intergenic
958120536 3:89281771-89281793 GTCCCCTGAAACTCTCCAGTGGG + Intronic
961057109 3:123798543-123798565 GGCCCATGGAAATCTCCTGAAGG + Intronic
962404883 3:135092316-135092338 GGCCCCTGGCACCCAACAGAAGG - Intronic
965250927 3:166342959-166342981 GGCCACTGGAATGCTCCAGATGG + Intergenic
966860668 3:184229684-184229706 GGCACCTAGAACTCCGCGGAGGG + Intronic
967650129 3:191975316-191975338 GTTCTCTGGAACTTTGCAGATGG - Intergenic
967685020 3:192408901-192408923 GGCCCCTGGAAAGCCGCAGCCGG - Exonic
968427599 4:533998-534020 GGCCCCCAGAACTGTGCTGACGG - Intronic
969204605 4:5633995-5634017 GGCCCTTGGACCTCTTTAGAAGG - Intronic
969465998 4:7356834-7356856 GATCCCTGGATCTCTGGAGAGGG + Intronic
969466115 4:7357458-7357480 GGCTGCTGGAGCTCTGGAGATGG + Intronic
969680408 4:8640106-8640128 GGCCCCAGGGACTCCGGAGAGGG - Intergenic
969835083 4:9833926-9833948 GGCCCCTTGCTCTGTGCAGAAGG + Intronic
975169035 4:71212412-71212434 GGCCTCTGGAGCTGGGCAGAAGG + Intronic
976186762 4:82449787-82449809 GGACCCAGGAGCACTGCAGAGGG - Intronic
980625608 4:135371466-135371488 GGCCCCCTGTGCTCTGCAGATGG - Intergenic
988813495 5:34807656-34807678 GGCCCCTGGAACACAGCAGCTGG + Intronic
989535813 5:42562442-42562464 GCCGCCTGGAACACTGCATAGGG - Intronic
990339450 5:54808212-54808234 GGCTGCTGGAGCTTTGCAGAAGG + Intergenic
990545604 5:56817031-56817053 GGCCCCTGGAATTCAGCGGGCGG - Intronic
991092520 5:62706732-62706754 AGGCCCTGGAAATCTGCCGAGGG + Intergenic
997259398 5:132454438-132454460 TACCCCTGGAACCCTGCAGGAGG - Intronic
997593655 5:135091810-135091832 GGCCCATGGAAACCTGAAGATGG + Intronic
999241716 5:150131853-150131875 GGAGCCTGGAACTCAGGAGATGG - Intronic
1000359078 5:160431226-160431248 GAACCCTGGAAATTTGCAGAGGG - Intergenic
1003485910 6:6579554-6579576 GGCCACTGGACCTCTGCATTTGG - Intergenic
1004225886 6:13784062-13784084 GGCCTTTGGGACACTGCAGAGGG - Intergenic
1005449969 6:25962970-25962992 GGCCCCTCCAACTCTGAAAATGG + Intronic
1006390840 6:33757358-33757380 CGCCTCTGGAACTCAGCAGAGGG - Intergenic
1007419067 6:41708395-41708417 GGCACCTGGAAATCTTCAGGTGG - Intronic
1007818087 6:44538948-44538970 GGCCCCTGGTCCCCTGAAGATGG + Intergenic
1008050241 6:46893578-46893600 GGTCCCTGGTAGTCTGGAGAAGG - Intronic
1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG + Intronic
1013173649 6:107659603-107659625 GGCACCTGGACCCCTCCAGAGGG - Exonic
1013294618 6:108747495-108747517 GGCCACGTGAACTCTGAAGATGG - Intergenic
1013447998 6:110250638-110250660 GGCCCTTGGATCTCTGGAGTAGG - Intronic
1015517482 6:134098360-134098382 GGCCCCTTGAAGTCCTCAGAAGG + Intergenic
1016422094 6:143896121-143896143 GGCCTCTGGGACCCTACAGAAGG - Intronic
1018229217 6:161659784-161659806 AGCCCCTGGGTATCTGCAGAAGG + Intronic
1019310394 7:357616-357638 GGGCCCTGGGGCTCTGCAGGAGG + Intergenic
1019702457 7:2480524-2480546 GGACCCTGGAGCTCTGCAGAGGG + Intergenic
1020007139 7:4789027-4789049 GCCCTCTTGAGCTCTGCAGAAGG + Intronic
1022509182 7:30924216-30924238 GGTCCCTGCCACTTTGCAGAAGG - Exonic
1022644398 7:32216971-32216993 GGCCCCTGGTACTAGGCATAAGG + Intronic
1024005219 7:45220159-45220181 GACCCGTGGAGGTCTGCAGATGG - Intergenic
1028984475 7:96998872-96998894 GGCCCCTGGTTCCCTGCAGACGG + Intergenic
1029935442 7:104420053-104420075 GCCCCCTGGAACTCTTCATGGGG - Intronic
1030441652 7:109595336-109595358 AGCCCCTGGAACTCTGCCCCAGG - Intergenic
1031296649 7:120011289-120011311 AGCCCCTGGAACTCGGCCCAAGG + Intergenic
1032136420 7:129283103-129283125 AGCACCTGGAGCTCTGCAGTGGG - Intronic
1033522536 7:142175610-142175632 GGCTCTTGGAACCCTGCAGTAGG - Intronic
1033705280 7:143880753-143880775 GGTCCCTTGAACTCTGCAGCTGG + Intronic
1034825230 7:154256341-154256363 GGCACCTCCAGCTCTGCAGAGGG + Intronic
1035015602 7:155763187-155763209 GGCACTTGTAACTCAGCAGAAGG + Intronic
1035037176 7:155902916-155902938 AGCCCCTTCCACTCTGCAGAGGG - Intergenic
1035286777 7:157811872-157811894 GGTCCCTGGAACTCAGGACAAGG + Intronic
1035999982 8:4591832-4591854 GGCCTCTGGAACAAGGCAGAGGG + Intronic
1036795970 8:11757126-11757148 GGCCTCTGGGACTCTGCAGTCGG - Intronic
1039479568 8:37862207-37862229 GGGCCCTGGATCTAAGCAGAAGG + Exonic
1041562948 8:59241341-59241363 GGGCCCTTGCACTCTGCACAAGG - Intergenic
1042536868 8:69867915-69867937 GGCCCTTGGATCTCTGGAAATGG + Intergenic
1044628431 8:94256686-94256708 GGCCCGTGGAGCTGTCCAGAGGG - Intronic
1045509926 8:102806424-102806446 CGCCCCGGCAGCTCTGCAGAGGG + Intergenic
1048013386 8:130476635-130476657 GGCCCCAGGGACTGTGCTGAGGG - Intergenic
1048332118 8:133477951-133477973 GGGCCCTGGATGTCTTCAGAAGG - Intronic
1051851185 9:21510274-21510296 GGTACATGGAACTCTGCAAAAGG + Intergenic
1052786717 9:32835066-32835088 CAGCCTTGGAACTCTGCAGAGGG + Intergenic
1056538948 9:87554957-87554979 GGCCCCTTGATCTCTGGAGAGGG + Intronic
1056708524 9:88971553-88971575 GGCCCCTGGAGCTCTGCGCCAGG - Intergenic
1057157314 9:92854298-92854320 GGTCCCTGGAACTTTGTACAAGG - Intronic
1058007804 9:99938219-99938241 GAGCCCTGGAAATATGCAGAGGG - Intronic
1058119187 9:101119691-101119713 GGCCTCTGGTGATCTGCAGAAGG - Intronic
1059341268 9:113598795-113598817 GTCCCCTGTAACCCTGAAGAGGG - Intergenic
1059474428 9:114532982-114533004 GAACTCTGGAACTCTACAGAAGG + Intergenic
1060048289 9:120358503-120358525 GGCCTCTTGGACTGTGCAGATGG - Intergenic
1061365114 9:130168597-130168619 GGCCCCAGGAAGTCTTCAGATGG + Intergenic
1061365519 9:130170989-130171011 GGCCCCAGGAAGTCTTCAGATGG - Intergenic
1062109356 9:134773556-134773578 GGCCTCTGGAACCCTGGAGCAGG - Intronic
1062317876 9:135977374-135977396 GGCCCCTCTCACTCTGCAGTGGG + Intergenic
1186034593 X:5408040-5408062 ATCCCCTGGAAATTTGCAGAAGG - Intergenic
1188326678 X:28812059-28812081 TTCCCCTGGAATCCTGCAGAAGG - Intronic
1189577960 X:42375505-42375527 GGCCCCAGGGCCTTTGCAGAAGG + Intergenic
1190524169 X:51311413-51311435 GGCCTCTGGAACCCAGCAGGAGG - Intergenic
1191029241 X:55950136-55950158 TTCCTCTGGAACACTGCAGAAGG - Intergenic
1196759748 X:119190491-119190513 GGCCCCTGGGACACAGCACAGGG - Intergenic
1197138598 X:123091397-123091419 GAGACCTGGACCTCTGCAGAGGG - Intergenic
1198045764 X:132900996-132901018 GCCCCATGGAACTCTGCATAGGG - Intronic