ID: 1008372064

View in Genome Browser
Species Human (GRCh38)
Location 6:50744189-50744211
Sequence GAGGGTAAAAAGTAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 1, 2: 7, 3: 87, 4: 790}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008372064 Original CRISPR GAGGGTAAAAAGTAGGAGGG TGG (reversed) Intronic
900107704 1:991873-991895 GAGTGTCAAAAGTAAGAGGCAGG + Intergenic
900391503 1:2435956-2435978 GAGGGAAGAAGGGAGGAGGGAGG - Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900862958 1:5246077-5246099 GAGGGAGAAAAGAAGGAAGGAGG - Intergenic
900932866 1:5747748-5747770 GAGGGAGAAAGGGAGGAGGGAGG + Intergenic
900970065 1:5987027-5987049 GAGAGGAAAAGGTAGGAGTGAGG + Intronic
901813079 1:11778813-11778835 GAAGGTGAGAGGTAGGAGGGTGG + Exonic
901872646 1:12147061-12147083 GAGGGAAAAAAGGAGGTGAGGGG + Intergenic
902038607 1:13475816-13475838 GAGAGTAAGAGGCAGGAGGGAGG + Exonic
902137953 1:14326906-14326928 GAGGCTATAAAGCAGGATGGGGG - Intergenic
902512743 1:16975114-16975136 GAGGATGAAAAGTAGCAAGGAGG + Intronic
902557433 1:17255276-17255298 GGGGGTAAAATGTGGTAGGGTGG - Intronic
902665634 1:17935761-17935783 GAGGGAAGAAGGTGGGAGGGAGG - Intergenic
902690797 1:18109209-18109231 GAGGCTAAAAGCCAGGAGGGAGG + Intronic
902858874 1:19230218-19230240 GAGGGTAGAAGGTAGGAATGTGG - Intronic
903865207 1:26392774-26392796 GAGGGTAAAAAGAAGTGGGTGGG + Intergenic
904343231 1:29851586-29851608 GAGGGAAAGAAGTAGGCAGGTGG + Intergenic
904480736 1:30791724-30791746 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905020790 1:34809872-34809894 GAAGGGCAAAAGTGGGAGGGGGG + Intronic
905037127 1:34925536-34925558 GAGGGGAAGAAGCAGGAGCGAGG + Intronic
905154521 1:35964267-35964289 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
905204080 1:36332998-36333020 TGGGGTAACAAGGAGGAGGGGGG - Intergenic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906370671 1:45250647-45250669 GAAGGAAGAAAGAAGGAGGGAGG + Intronic
906851557 1:49256007-49256029 GAGAGTAAAAAGTGGGAGAATGG + Intronic
907071467 1:51539465-51539487 GAGGGTAAAGAATAGGTGAGGGG - Intergenic
907669874 1:56464966-56464988 GAAGGTACAAAGGAGGAAGGAGG + Intergenic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908626456 1:66049361-66049383 GAGGGAAAAGAGTGGGAGTGTGG + Intronic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909695131 1:78459636-78459658 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
910677977 1:89833911-89833933 GAGAGCCCAAAGTAGGAGGGGGG - Intronic
911091994 1:94024594-94024616 GAGAGTAAAAATTTGGAGGGAGG - Intronic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
912281961 1:108325334-108325356 GAAGGTAGAAGGTAGGAGGAGGG - Intergenic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
915363644 1:155301231-155301253 GAGGGTGAAAACTAGGAGCCAGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915818302 1:158993675-158993697 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
916135238 1:161646978-161647000 AAGGGTAAAATTCAGGAGGGTGG - Intronic
916276081 1:162994753-162994775 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
916881241 1:169021492-169021514 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
917216500 1:172683782-172683804 GAGGGTAGAAAGTAGGAGAAGGG - Intergenic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917598354 1:176552290-176552312 GAGGGTAAAATGGAAGGGGGAGG - Intronic
917661818 1:177184303-177184325 GAGGGTGAAAAGTAAGGGGAGGG - Intronic
918327716 1:183426343-183426365 GGAGGGAATAAGTAGGAGGGAGG - Intergenic
918431779 1:184468401-184468423 GGGGGAAAAAAGGAGGAAGGTGG + Intronic
918490589 1:185077298-185077320 GAGGGAGAGAAGTAGGAGGGAGG - Intronic
918946152 1:191068108-191068130 GAGGGTGGAAATTAGGAGGAGGG + Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919626976 1:199920676-199920698 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
919629660 1:199947966-199947988 GAGGGTGCAAAGTAGGAGGAGGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920141941 1:203822411-203822433 GGGGGTCAAAAGTAGGATGTTGG - Intronic
920840434 1:209549480-209549502 GAGGAGGAATAGTAGGAGGGAGG - Intergenic
921124004 1:212160925-212160947 TAGGGTAAAAAGTTGGTAGGGGG - Intergenic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
921382540 1:214539658-214539680 GAAGGGAAGAAGGAGGAGGGAGG + Intronic
921382551 1:214539709-214539731 GAGGGAAGAGAGGAGGAGGGAGG + Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921868575 1:220112433-220112455 AGGGGTAAAAAGTAGGTGGTCGG - Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922071532 1:222199308-222199330 GAGGGTAGAGAGTCGGAGGAGGG - Intergenic
922096591 1:222448030-222448052 GAGGGGAAAAGGCTGGAGGGAGG - Intergenic
922163535 1:223096320-223096342 GAGGGTAGAAGGTGGGAGGAAGG - Intergenic
922722731 1:227906811-227906833 GGAGGAAAAAAGGAGGAGGGAGG - Intergenic
922722760 1:227906914-227906936 GAGGGAAGAAAGTAGGAGGAGGG - Intergenic
923052088 1:230396157-230396179 GTGGGTAAAAGGGAGGAGTGTGG - Intronic
923052108 1:230396234-230396256 GGGGGTAAAAGGGAGGAGTGTGG - Intronic
923052115 1:230396255-230396277 GGGGGTAAAAAGGAGGAGTGTGG - Intronic
923278825 1:232421776-232421798 GAAGTTAAAAAGTGGGAGAGTGG - Intronic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923460766 1:234207402-234207424 GAGGGAGAAAGGAAGGAGGGAGG - Intronic
923851979 1:237805969-237805991 GGAAGTAAAAAGTAGGAGAGAGG - Intronic
924059269 1:240154853-240154875 GAGGGAAGAAAGAAAGAGGGAGG - Intronic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924293975 1:242566898-242566920 GAGGGTTAAAAGAGGGAGAGGGG - Intergenic
924802045 1:247334823-247334845 GAGGGTTTCAAGTAGGAGTGTGG + Intergenic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1062951124 10:1504362-1504384 GAGGGGAAAAAGTAAGGGGTGGG - Intronic
1063812541 10:9728958-9728980 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1064231182 10:13529856-13529878 GAGGGTAAAGAGTCGGGGGATGG + Intergenic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1065259773 10:23912478-23912500 AAGGGGAAAAAGTAGGAGAGGGG - Intronic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1066258402 10:33704295-33704317 GAAGGAGAAAAGCAGGAGGGAGG - Intergenic
1066553417 10:36584579-36584601 AAGGATGAAAAGTAGGAAGGAGG - Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067924531 10:50494626-50494648 GAGGGTAGAGGGTAGGAGGAGGG + Intronic
1068022340 10:51601001-51601023 GAGGGGGAAAAGAAGAAGGGAGG + Intronic
1068711597 10:60141064-60141086 GAGGGGAAAAAGAGAGAGGGAGG + Intronic
1068873691 10:61973606-61973628 CAGTGTAAAAAATGGGAGGGGGG + Intronic
1069291976 10:66791022-66791044 GAGGGTAAAAAGTAACAGGTAGG - Intronic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1070053961 10:72916316-72916338 GAGAGTGGAAGGTAGGAGGGGGG - Intronic
1070504792 10:77103772-77103794 GAGGGGAAAAAGATGGAGAGGGG - Intronic
1070541533 10:77418714-77418736 GAGGGGACATGGTAGGAGGGAGG - Intronic
1071161648 10:82753528-82753550 GAGGAAAGAAAGAAGGAGGGAGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1072911766 10:99508313-99508335 GAAGGAAGAAAGTGGGAGGGAGG + Intergenic
1073484817 10:103810008-103810030 GAGGGTAATGAGTAGGTGAGAGG + Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1075191878 10:120316648-120316670 GATGTTAAAATGTAGGAGGTAGG - Intergenic
1075324528 10:121520180-121520202 GAGGGAAGAAAGGAGGAGTGGGG + Intronic
1075845395 10:125541080-125541102 GATGGTGAAAAGCAAGAGGGAGG + Intergenic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076778112 10:132709316-132709338 GAGGGGGAAAAGAAGGAGGTGGG + Intronic
1077344059 11:2038315-2038337 GAGGGTAGAGAGTGGGAGGGAGG + Intergenic
1077497352 11:2892609-2892631 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1077644584 11:3912166-3912188 GAGGGGAGAAAGGAGGAGAGGGG - Intronic
1078267656 11:9766885-9766907 GAGGGGATAAAGGAGGAGAGGGG - Intergenic
1078351257 11:10595838-10595860 GAGGGTGGAAAGTAGGAGGAGGG - Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080609808 11:33894072-33894094 GAGGGTGATGAGTAGGAGAGCGG + Intergenic
1080661068 11:34296321-34296343 GAGGGAGACAAGGAGGAGGGTGG + Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082101753 11:48178576-48178598 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1082172226 11:49018922-49018944 GAGGGTCGGTAGTAGGAGGGAGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1083445799 11:62707371-62707393 GAGGGAGGAAAGGAGGAGGGGGG + Exonic
1083467095 11:62855677-62855699 GAGGCTTAAAAGTAGCAGTGGGG - Intergenic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084470497 11:69356476-69356498 GAGGGAGGAAAGAAGGAGGGAGG + Intronic
1084978058 11:72814168-72814190 GAGGGTCATAAGCAGGAGCGAGG - Intergenic
1085649979 11:78259015-78259037 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
1085914227 11:80865509-80865531 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1087287324 11:96278947-96278969 GTGGGTATAAAGGAGAAGGGAGG + Intronic
1087296001 11:96374753-96374775 GAGGGTGGAGAGTAGGAGGAGGG - Intronic
1087563082 11:99816175-99816197 GAAGGAAAAAAGTAGGAAAGTGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1087741144 11:101888355-101888377 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1087815033 11:102648921-102648943 GAGGGTAGAAAGTGGGAGAAGGG - Intergenic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088508291 11:110548360-110548382 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1090550332 11:127812583-127812605 ATGGGTAAATAGTGGGAGGGAGG - Intergenic
1090609920 11:128461913-128461935 GAGGGCAAAAAAGAGGTGGGTGG - Exonic
1202827045 11_KI270721v1_random:93504-93526 GAGGGTAGAGAGTGGGAGGGAGG + Intergenic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1092594180 12:9982790-9982812 GACTCCAAAAAGTAGGAGGGTGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093442422 12:19214387-19214409 GAGGGAAAGAGGTGGGAGGGAGG + Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093846687 12:23980678-23980700 GAGGGGAAAACGGAAGAGGGGGG - Intergenic
1094559898 12:31542363-31542385 AAGGGTAGAAGGTAGGATGGGGG + Intronic
1096001794 12:48136186-48136208 GAGGTTAAGAATGAGGAGGGAGG - Intronic
1096449952 12:51730887-51730909 GAGGATAGAAAGTAGAAGGATGG - Intronic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1096929519 12:55191155-55191177 GAGGGTAGAGGGTAGGAGGAGGG - Intergenic
1097426722 12:59454835-59454857 AGGGGGAAAAAGTGGGAGGGTGG + Intergenic
1097753429 12:63383355-63383377 GAGTGATAAAAGTGGGAGGGAGG - Intergenic
1098070169 12:66665479-66665501 GAGGGTAGAAGTTAGGATGGTGG - Intronic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1098205095 12:68100564-68100586 GAGGGTAACACGGAGAAGGGTGG + Intergenic
1098212126 12:68177542-68177564 GAGGGTAAGAAGAGAGAGGGAGG + Intergenic
1098327138 12:69314991-69315013 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1098562432 12:71889782-71889804 GAGGGTGGAAAGTGGGAGGAGGG - Intronic
1098666945 12:73176229-73176251 GAGATTACAAAGTAGGAGGAGGG + Intergenic
1098833390 12:75390975-75390997 GAGGGAAAAACAAAGGAGGGAGG - Intergenic
1098980803 12:76953552-76953574 GAGGGTAAGTGGTAGGAGGCAGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099110425 12:78553265-78553287 GAGAGTAAAAAGGAAGAGAGAGG - Intergenic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1099712248 12:86242684-86242706 GAGGGAAAAATGGAGGAAGGGGG + Intronic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1099987140 12:89679674-89679696 GAGGGTACATCGTAGGAGAGGGG + Intronic
1101629470 12:106478989-106479011 AAAGGAATAAAGTAGGAGGGAGG - Intronic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1102548609 12:113674664-113674686 GAGGGAAAAAACTAGGAGAAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102764793 12:115423208-115423230 GAGGAAAAAGAGGAGGAGGGAGG + Intergenic
1102765470 12:115429226-115429248 GAGAGGGAAAGGTAGGAGGGTGG - Intergenic
1102796741 12:115695495-115695517 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1102947674 12:117004242-117004264 GAGGATAAAAAGTAGGAAATCGG - Intronic
1102969874 12:117157951-117157973 GAGCGCAAAAAGGAGGAGGTGGG - Exonic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103223259 12:119264431-119264453 GGGGAGAAAAGGTAGGAGGGAGG + Intergenic
1103819955 12:123689653-123689675 GAGGGTAGTGAGTAGGAGGAGGG - Intronic
1104693670 12:130847161-130847183 GAGGGTAGAGGGTAGGAGGAGGG - Intergenic
1104809044 12:131609502-131609524 GAGGCTCAGAAGGAGGAGGGCGG - Intergenic
1105273888 13:18903791-18903813 GAGGGTGGCAAGGAGGAGGGGGG - Intergenic
1105806734 13:23955810-23955832 GAGGGTGGCAAGGAGGAGGGGGG + Intergenic
1106363578 13:29055511-29055533 GAGGGTAGAAGGTGGGAGGAGGG - Intronic
1106882876 13:34150864-34150886 GAGGCAAAAATGAAGGAGGGGGG - Intergenic
1106998002 13:35509713-35509735 GTGGGAAAAAATTAGGAGAGTGG + Intronic
1107216844 13:37931651-37931673 GAGGGTGAAGACTAAGAGGGAGG - Intergenic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107533764 13:41308866-41308888 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1107737324 13:43413437-43413459 GAGGGAAAAAAGTTGGGAGGAGG + Intronic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1107917641 13:45168900-45168922 GAGGGAAGGAAGGAGGAGGGAGG - Intronic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108436575 13:50406776-50406798 GAGGGGGGAAAGAAGGAGGGAGG - Intronic
1108971117 13:56378462-56378484 GAGGGAAGAAGGGAGGAGGGAGG + Intergenic
1109451254 13:62517923-62517945 GAGGTTAAAAGGTAGGAAGTTGG - Intergenic
1109922169 13:69079257-69079279 GAGGAGAAAGAGTAGGAGAGAGG - Intergenic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1112441440 13:99427157-99427179 GAGGGTGAAAGGGAGGAGGGAGG + Intergenic
1112682441 13:101782529-101782551 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1113206025 13:107917028-107917050 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114370415 14:22081118-22081140 GAAGGTAAAAAGAATGAGAGGGG - Intergenic
1114586630 14:23820552-23820574 GAGGGTGGAAGGTAGGAGGAGGG - Intergenic
1114709667 14:24765746-24765768 GAGGGAAAGAAGGAGGAGTGGGG + Intergenic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1115778666 14:36745014-36745036 GAGGGGAACATGTTGGAGGGTGG - Intronic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116126524 14:40795536-40795558 GTGGGTAAGAAGGAGGAGTGGGG + Intergenic
1116738231 14:48721774-48721796 GAAGCTACAAGGTAGGAGGGAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117043105 14:51785959-51785981 GAGGGTAGAAGGTGGGAGGATGG - Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117845125 14:59903737-59903759 GAGGGAAAAAAGGAGGGGAGGGG - Intergenic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118426459 14:65669028-65669050 GAGGGTGAAAGGTGGGAGGAGGG + Intronic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118749185 14:68794214-68794236 GAAGGTAAAGAGGTGGAGGGAGG + Intronic
1120030877 14:79639358-79639380 GAGGGTAGAGGGTAGGAGGAAGG - Intronic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120428780 14:84387184-84387206 GAGGGAAGAAACGAGGAGGGAGG - Intergenic
1120638435 14:86980385-86980407 GAGGGTGAAGAGTAGGAGTGGGG + Intergenic
1120899906 14:89566864-89566886 GAGGGTAAGGAAGAGGAGGGGGG - Intronic
1121195126 14:92065104-92065126 GTGGGTAAAAGATAGGTGGGTGG - Intronic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123878928 15:24656209-24656231 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124434096 15:29633545-29633567 GAGGGACAAAAATAGAAGGGTGG + Intergenic
1125210728 15:37212316-37212338 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125484900 15:40105135-40105157 GAGGGTAAAGGCTAGGAGCGTGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1125953779 15:43775936-43775958 GGTGGAAAAAAATAGGAGGGTGG + Intronic
1126081928 15:44971825-44971847 AAGGGAAAAAAGGAGGGGGGGGG - Intronic
1126305345 15:47249474-47249496 GTGGGTAGAGAGTAGGGGGGTGG - Intronic
1126371952 15:47956641-47956663 GAGGGTGGAAAGTGGGAGGAAGG - Intergenic
1126634084 15:50765273-50765295 GAGGGTGGAAAAGAGGAGGGTGG + Intronic
1126951127 15:53882895-53882917 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1127223211 15:56902106-56902128 GAAGGAATAAAGAAGGAGGGAGG + Intronic
1127825136 15:62696334-62696356 GAAGGTAAAAAGTCTGAGGGTGG - Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1129119526 15:73387532-73387554 GAGGGAAAAAAGAGGGAGTGAGG + Intergenic
1129924606 15:79352063-79352085 GGGGGGAAAGAGTAGGAGGGGGG + Intronic
1130219529 15:82007562-82007584 GAGGGTGAGAACTAGGATGGTGG - Intergenic
1130909170 15:88259141-88259163 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1131113156 15:89777513-89777535 GAGGGTGGAAAGTAGCAGGGTGG + Intronic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133614164 16:7460565-7460587 GAGGGTGGAAGGTAGGAGGATGG + Intronic
1133712229 16:8412319-8412341 TAGGGGGAAGAGTAGGAGGGAGG + Intergenic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1136230530 16:28883004-28883026 GAGGGCAGAAGGGAGGAGGGAGG + Intronic
1137552177 16:49445266-49445288 GAGGGAAAAAAGAGGGAGAGAGG - Intergenic
1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG + Intergenic
1138058796 16:53865372-53865394 GAGGATAAAAAGCAGAAGTGTGG - Intronic
1138316343 16:56073347-56073369 GAGGGGAAAAAGGATGGGGGAGG - Intergenic
1138429974 16:56962418-56962440 GGGGGTAAAGATTAGGAGGTTGG + Intronic
1139164291 16:64547808-64547830 GAGGGCAGAGAGTGGGAGGGAGG - Intergenic
1139692947 16:68652708-68652730 GAAGGTTGAAATTAGGAGGGAGG - Intronic
1140108628 16:71983994-71984016 GAGGGAAGAAGGTAGGAGAGAGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141021922 16:80505469-80505491 TAGGGTACAGAGTGGGAGGGTGG - Intergenic
1141023893 16:80525365-80525387 GATGGCAAAAAACAGGAGGGAGG - Intergenic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141686848 16:85575052-85575074 GAGCGTAAAAAGCCGGGGGGCGG - Intergenic
1142312938 16:89324350-89324372 GAGGGAAAAAGCCAGGAGGGCGG + Intronic
1142958249 17:3535472-3535494 GAGGGAAGAAGGGAGGAGGGGGG - Intronic
1144079829 17:11753956-11753978 GAGGGTACAAGGTAGGAGGAGGG - Intronic
1144611774 17:16725621-16725643 GTGGGGAAAGAGTGGGAGGGGGG + Intronic
1144900965 17:18589765-18589787 GTGGGGAAAGAGTGGGAGGGGGG - Intergenic
1145102971 17:20092047-20092069 GAGGGAGAAAAGGAGGAGAGAGG - Intronic
1145131541 17:20356302-20356324 GTGGGGAAAGAGTGGGAGGGGGG + Intergenic
1146000332 17:29126830-29126852 GAGGCTGAGAAGCAGGAGGGAGG - Intronic
1146235610 17:31158121-31158143 AAGAGTAAAAAGTAGAAGAGAGG - Intronic
1146371788 17:32269045-32269067 GAGGGAAAGAAGTTGGAGTGGGG + Intronic
1146700059 17:34949494-34949516 GAGGGAAGAAGGAAGGAGGGAGG + Intronic
1146802117 17:35833283-35833305 GTGGGTATAGAGTAGGAGGGCGG + Intronic
1146964540 17:37013908-37013930 AAGGGGAAAAAGTAGAAGGGAGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1148798069 17:50206960-50206982 GGGGGAAAAAAGTATGTGGGTGG - Intergenic
1150198583 17:63328188-63328210 GAGGGTGGAAAGTAGGAGGAAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150645709 17:66976382-66976404 GATGGAAAGAAGTTGGAGGGAGG - Intronic
1150672738 17:67216145-67216167 GAAGGTGAGAAGTAGGAGTGGGG - Intronic
1150885456 17:69080671-69080693 GAGGGATAAAAGTGGGAAGGAGG + Intronic
1150947743 17:69765760-69765782 GAGGGGAGAAGGTAGAAGGGAGG - Intergenic
1150947752 17:69765784-69765806 GAGGGGAGAGAGTAGAAGGGAGG - Intergenic
1151103369 17:71581788-71581810 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1151170448 17:72241403-72241425 AAGGGTAAAAAGTAGGAGTTAGG + Intergenic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1152336111 17:79701036-79701058 GAGGGGCACAGGTAGGAGGGTGG + Intergenic
1152336155 17:79701151-79701173 GAGGGGCACAGGTAGGAGGGTGG + Intergenic
1152336190 17:79701241-79701263 GAGGGTCACAGGTGGGAGGGTGG + Intergenic
1152336277 17:79701467-79701489 GAGGGTGACAGGTGGGAGGGTGG + Intergenic
1152913083 17:83016628-83016650 GAGGGACAGAAGAAGGAGGGAGG + Intronic
1153064167 18:1026187-1026209 GAGGGTAGAGAGTGGGAGGTGGG + Intergenic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1155303152 18:24451878-24451900 GAGGGGAAAAAATGGGGGGGAGG - Exonic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1155479861 18:26273693-26273715 GAGGGTAAAAAATGGGAAGAAGG - Intronic
1155741556 18:29295324-29295346 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1155780402 18:29825510-29825532 TAGGGTAAAGAGTAGGACAGTGG - Intergenic
1155991670 18:32285048-32285070 CCGGGTAAAAAGTAAGGGGGCGG - Intronic
1156261806 18:35451468-35451490 GAGGGAAAAGGGTAGGAGGGAGG + Intronic
1156337114 18:36181999-36182021 GGGGGCAAAGAGTAGGAGGGAGG + Intergenic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1157467500 18:47959993-47960015 GAAGGCAAAGAGTAGGATGGTGG - Intergenic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1158063179 18:53372457-53372479 GAGGGTAAAGGGTAGGGGGAGGG + Intronic
1158103765 18:53861333-53861355 GAGGGAGGAAAGAAGGAGGGAGG + Intergenic
1158103772 18:53861352-53861374 GAGGGAGGAAAGGAGGAGGGAGG + Intergenic
1158103829 18:53861499-53861521 GAGGGCAGAAGGAAGGAGGGAGG + Intergenic
1158126921 18:54110412-54110434 GAGGGTGAAGGGTGGGAGGGGGG - Intergenic
1158744328 18:60180938-60180960 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1159159833 18:64629537-64629559 GGGGGAAAAAACAAGGAGGGAGG - Intergenic
1159277470 18:66239330-66239352 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1159951861 18:74489946-74489968 GAGGGAACAAGGGAGGAGGGAGG + Intergenic
1160991389 19:1861744-1861766 GAGGGTGGAGAGCAGGAGGGCGG - Intronic
1161631635 19:5359693-5359715 GAGGGTACAAAGTCCGAGTGGGG - Intergenic
1162115856 19:8428993-8429015 TAGGGAGAAAAGTGGGAGGGAGG + Intronic
1162753568 19:12843610-12843632 GAGTGTGGAAAGTAGGTGGGTGG + Intronic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164446400 19:28321270-28321292 GAGATTCAAAAGCAGGAGGGTGG + Intergenic
1164712592 19:30368078-30368100 GAGGGACAGGAGTAGGAGGGAGG - Intronic
1165213550 19:34254094-34254116 GAGGGGAAAGAGTAAGAGGGAGG - Intergenic
1165652743 19:37505697-37505719 GAGTGTGAATAGTAGGAGGTAGG + Intergenic
1166081440 19:40446164-40446186 GAGGGGAATAGGTAGGTGGGTGG + Intergenic
1166898502 19:46039959-46039981 GAGGGGAATAAGAGGGAGGGTGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167428794 19:49442850-49442872 GAGGGTCAGAAGTCGGAGGGCGG - Intergenic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
925330332 2:3053562-3053584 GAGGAAGAAAAGTAGGAAGGAGG + Intergenic
925577896 2:5379729-5379751 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
925822927 2:7818225-7818247 GCGGGTAAAGGGTAGGAAGGCGG + Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
927253415 2:21018659-21018681 GAGGGCTAGGAGTAGGAGGGAGG - Intronic
928565574 2:32544069-32544091 GAGGTTAAAATGTATGAGAGGGG + Intronic
929071978 2:38039901-38039923 GATGCTAAAAAGTAGTAGGAAGG - Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
930066556 2:47332303-47332325 GAGGGTGAGGAGTAGGAGGTGGG + Intergenic
930541435 2:52711788-52711810 GAGGGTAAAAACGTGGAGGTAGG - Intergenic
930933600 2:56919307-56919329 GAGAGTAGAAAGTGGGAGGTTGG + Intergenic
931152069 2:59585359-59585381 GCGGGTAAAAAGGTGGGGGGAGG + Intergenic
931171925 2:59812800-59812822 AAGGGTCTAAAGCAGGAGGGTGG - Intergenic
931624076 2:64240197-64240219 GAGGGTAGCAGGTAGGAGGAAGG - Intergenic
932132648 2:69201697-69201719 GAGGGTAGAAAGTGTGAAGGAGG + Intronic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932243341 2:70175336-70175358 GAGGGTGAAACGTGGGAGGAGGG - Intronic
932496646 2:72148850-72148872 GAGGGGGAAAAGCAGGAGGCAGG + Intergenic
932778607 2:74545240-74545262 GAGGGTAAAAACAAAGATGGAGG - Intronic
933233580 2:79838338-79838360 GAAGGAAGAATGTAGGAGGGTGG + Intronic
933281288 2:80335368-80335390 GAGGGTAAGAAAGAGGAGTGAGG + Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
935022775 2:99247596-99247618 GACTGTAAAAGGAAGGAGGGAGG - Intronic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936600431 2:113889988-113890010 GAGGGGAAGAAGTTGTAGGGTGG + Exonic
936729602 2:115364378-115364400 GAGGGTAAAAAGTGATAGTGTGG - Intronic
936740947 2:115507895-115507917 GAAGGTAAAAAGTAGGTGGGTGG + Intronic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937225913 2:120368570-120368592 GAGGGGAAGAGGGAGGAGGGTGG + Intergenic
937538116 2:122915964-122915986 GAGGGTAGGAAGTGGGAGGAGGG + Intergenic
937653582 2:124348084-124348106 GTGGGTAAAAATTATCAGGGAGG - Intronic
939156410 2:138529963-138529985 GAGGGTAAAGCGTGGGAGGAGGG - Intronic
939879100 2:147609730-147609752 GAGTGTACAAAGTGGTAGGGAGG - Intergenic
939945316 2:148402511-148402533 GATGGGGAGAAGTAGGAGGGAGG - Intronic
940539107 2:154988074-154988096 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
940579493 2:155559590-155559612 GAGGGTGAAAGGTAGGTGGAGGG + Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942681069 2:178478973-178478995 GAGCGTAAAAAATAGGCTGGCGG + Intergenic
942724467 2:178991534-178991556 GAGGGTAAGAAGGAAGAAGGAGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943012912 2:182473632-182473654 GAGGGTGGAAGGTAGGAGGAGGG - Intronic
943132868 2:183877413-183877435 GCGGGGAAAGGGTAGGAGGGTGG - Intergenic
943322625 2:186464450-186464472 GAGACTCAGAAGTAGGAGGGTGG + Intergenic
943499747 2:188672434-188672456 GAGGGTGGAAGGTAGGAGGAGGG - Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943659092 2:190538152-190538174 GAAGATAAAAAGTAGGTTGGTGG - Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944399159 2:199305347-199305369 GGGGGTAAAAGGTGGGAGGAGGG + Intronic
944832728 2:203549113-203549135 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
944965046 2:204921840-204921862 GAGGGCCCAAAGTAGGAGGGTGG + Intronic
945187176 2:207151039-207151061 GAGGGTGAAAAGGAGGGGTGAGG + Intronic
945339561 2:208635822-208635844 GAGATTAAAAAGTAGAATGGTGG + Intronic
945396450 2:209324610-209324632 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945983770 2:216338547-216338569 GAGGGACAAAAGGAGGAGGTAGG - Intronic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947394371 2:229672589-229672611 GAGAGGAAAAAGGATGAGGGAGG + Intronic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948243096 2:236455049-236455071 GATGCTAAGAAGTAGGAGAGAGG + Intronic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948703074 2:239772855-239772877 GAGGGAGGAAAGGAGGAGGGAGG - Intronic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1168975606 20:1963223-1963245 GACGGAGAAAAGAAGGAGGGAGG + Intergenic
1169395739 20:5227518-5227540 GTGTGTAACAAGTAGGAAGGTGG + Intergenic
1169998317 20:11584598-11584620 GAGGGTGAAACATAGGAGGAGGG - Intergenic
1170184049 20:13567268-13567290 GAGGGTGAAGGGTGGGAGGGGGG + Intronic
1170758088 20:19222743-19222765 GAGGGAAGGAAGAAGGAGGGAGG - Intronic
1170912259 20:20584538-20584560 GAAGGTAAAAAGTGGGAAGATGG + Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1170962420 20:21037298-21037320 GACAGTAAAAGGTAGAAGGGGGG + Intergenic
1171983584 20:31644145-31644167 GAGGGTTGAAAGTAGGAAGTAGG - Intronic
1172587471 20:36094617-36094639 GAGTGTAAAAGGAAGGAAGGTGG + Intronic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1172974475 20:38895844-38895866 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974483 20:38895871-38895893 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974491 20:38895898-38895920 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974499 20:38895925-38895947 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1173430186 20:42980972-42980994 GAGGTTAAAAAGTTGGAGAAAGG - Intronic
1173437623 20:43047073-43047095 GAGGGGAAGAGGGAGGAGGGAGG - Intronic
1173648157 20:44646447-44646469 GAAGACAAAAAGGAGGAGGGAGG + Intronic
1174054435 20:47788266-47788288 CAACATAAAAAGTAGGAGGGAGG - Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174469351 20:50744648-50744670 GAGGGTGAAAAGCAGGAGGGAGG - Intronic
1174589795 20:51635838-51635860 GAGGGAAAAAGGAAGGAAGGAGG + Intronic
1175218842 20:57405553-57405575 GAAGGTAAACAGTAGTAGAGAGG + Intronic
1175293662 20:57894617-57894639 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175293681 20:57894689-57894711 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177718355 21:24870378-24870400 AAGGGTAAAAAATAGGATCGTGG + Intergenic
1177886418 21:26751231-26751253 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1178808574 21:35860130-35860152 GAGGGAGGAAAGAAGGAGGGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179033900 21:37743576-37743598 GAGGGAAGAAAGTAAGAGAGGGG - Intronic
1179141138 21:38726527-38726549 GAAGGAAAGAAGGAGGAGGGAGG - Intergenic
1179161238 21:38901082-38901104 GAGGGGGGAAAGTAGGAGGCTGG - Intergenic
1179292328 21:40029564-40029586 GAGGGTGGAGAGTAGGAGGCGGG + Intronic
1180631469 22:17233068-17233090 GAGGGGAAAGAGTAGTGGGGGGG + Intergenic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181663371 22:24370922-24370944 GAGGGAAAAAAGAAAGGGGGTGG + Intronic
1181858352 22:25799005-25799027 GAGGGTAAGAACTAGGGGGATGG - Intronic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181907342 22:26209822-26209844 AAAGGAAAAAAGTAGGAGGAAGG + Intronic
1182970721 22:34573607-34573629 TAGGGGAAAAGGTGGGAGGGGGG - Intergenic
1183143001 22:35961849-35961871 GAGGGTACAATGTTGGAAGGAGG - Intronic
1183392314 22:37552523-37552545 GAGAGCAAGAAGTTGGAGGGGGG - Intergenic
1183398257 22:37585628-37585650 GAGGGTTTAAAGCAGGAGAGTGG - Intergenic
1183613057 22:38923698-38923720 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183613072 22:38923747-38923769 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184381502 22:44147592-44147614 GAAGGTAAAAAGCAGGTGGAAGG + Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949278041 3:2310514-2310536 GAGGTGAAAAAGTGGGAAGGCGG - Intronic
949676786 3:6463554-6463576 GGGGGTAGAAAGGTGGAGGGAGG + Intergenic
950848432 3:16038032-16038054 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951275724 3:20683250-20683272 GAGGGTGAAATGTGGGAGGAGGG + Intergenic
951720547 3:25693216-25693238 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951906684 3:27713904-27713926 GAGGGAAAAAAGGAAGAAGGGGG - Intergenic
952008345 3:28868953-28868975 GAAGGTAGAGAGTAGGATGGTGG - Intergenic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
952535687 3:34306620-34306642 GAGGGTGAAGGGTAGGAGGTGGG - Intergenic
952740741 3:36731791-36731813 GAGGGAGAAAAGAAGGAGTGAGG - Intronic
952814377 3:37434535-37434557 GAGGGGAAAAAATAAGGGGGAGG - Intronic
953330046 3:42045196-42045218 GAGGGTAAAAATTTTGAAGGAGG + Intronic
954193172 3:48979071-48979093 GAGGGTAGGAAGCAGTAGGGAGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954433675 3:50484734-50484756 GAGGCTAACAAGCAAGAGGGAGG - Intronic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954522196 3:51238600-51238622 GAGGGTAGAGGGTAGGAGGACGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955409301 3:58645605-58645627 GAGGTTAAAAAGTACAAGTGTGG - Exonic
955424855 3:58777707-58777729 GTGGGGAAAAAGTAAGTGGGAGG + Intronic
955525511 3:59815732-59815754 AAGGGAAAAGAGTGGGAGGGGGG + Intronic
955536072 3:59925078-59925100 AAGGGAAAAAAATAGGAAGGAGG - Intronic
955536142 3:59925558-59925580 GAGGGTAAAGAATAGTAGGCAGG - Intronic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956360596 3:68442608-68442630 GAAGGAAAAAAGAAAGAGGGAGG + Intronic
956447366 3:69338682-69338704 GAGGGTAGAGGGTAGGAGGAGGG + Intronic
956669960 3:71678719-71678741 GATGGTATAAAATAGGGGGGTGG + Exonic
957387236 3:79511920-79511942 GAGGGTAAAAGGTGAGAGGAGGG + Intronic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
958092657 3:88896038-88896060 AAGGGTGAACAGTAGAAGGGGGG - Intergenic
958120015 3:89274213-89274235 GCTGGTACAAAGTGGGAGGGTGG - Intronic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
959539628 3:107524043-107524065 GAGGGGGAAGAGGAGGAGGGAGG + Intronic
959655243 3:108796831-108796853 GATGGTAAAAGGTAGAAGGCAGG + Intergenic
960268398 3:115647667-115647689 GATGGTAAGAATTAGGGGGGAGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
962057825 3:131891565-131891587 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963096290 3:141544989-141545011 GAGGGTGGAGAGTAGGAGGAGGG + Intronic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965033558 3:163405351-163405373 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
965883530 3:173415310-173415332 GATGGCAGGAAGTAGGAGGGGGG + Intronic
966381286 3:179347534-179347556 GAGGGGAAGAAGTTGGAAGGGGG + Intergenic
967122753 3:186397983-186398005 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967287595 3:187888642-187888664 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967687800 3:192437856-192437878 GTGGGCAAAGAGTAGGAGGCAGG - Intronic
968003623 3:195224669-195224691 GAGGGAAAGAGGCAGGAGGGAGG + Intronic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
970209920 4:13698516-13698538 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
970320191 4:14867855-14867877 GAGGGAGCACAGTAGGAGGGAGG - Intergenic
970535159 4:17023097-17023119 GAGGGAAAAAAGCTGGAGAGGGG + Intergenic
971568107 4:28171277-28171299 GAGATTAAAAAGTAGGAGCAAGG + Intergenic
971620174 4:28845626-28845648 GAGGGTAGAAAGTGGGAGGAGGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
973129316 4:46630590-46630612 GAGAGTGAAGAGTAGGAGAGTGG - Intergenic
973288159 4:48442691-48442713 GAGAGTGAGAAGTGGGAGGGGGG + Intergenic
973834503 4:54795785-54795807 GAGGGTTTAAAGTGGGAGAGGGG + Intergenic
974567927 4:63602337-63602359 GAGGGTAGAAGGCAGGAGGAGGG - Intergenic
974881777 4:67767484-67767506 GAGGGTGAAAGGTGGGAGGAAGG - Intergenic
974945636 4:68525108-68525130 GAGGGTAGAAGGTGGGAGGGGGG + Intergenic
974955552 4:68636606-68636628 GAGGGTAGAAGGTGGGAGGGGGG + Intronic
975342863 4:73260362-73260384 GAATATACAAAGTAGGAGGGAGG - Intergenic
975689673 4:76950655-76950677 GAGGGAGGAGAGTAGGAGGGAGG + Intronic
976815562 4:89144638-89144660 GAGGGTGGAAGGTAGGAGGAGGG - Intergenic
976836581 4:89381220-89381242 GAAGGTAAAGAGGTGGAGGGAGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
976927695 4:90521476-90521498 GAGGGTAAAAAGCTTGTGGGTGG - Intronic
977487525 4:97667011-97667033 GAGGGCAAGAAGTGGGATGGTGG - Intronic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978285994 4:107077270-107077292 GAAGGTCAAAAGTAGGAGATTGG + Intronic
978689445 4:111488796-111488818 GAGGGTAGAGGGTAGGAGGAGGG + Intergenic
979045672 4:115859578-115859600 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
979601924 4:122594682-122594704 GGTGGTAGAAATTAGGAGGGTGG - Intergenic
979879118 4:125931727-125931749 GAGGGTGAAGGGTAGGAGGAAGG - Intergenic
980240832 4:130172646-130172668 CAGGGTATAAGGTAGGAAGGAGG - Intergenic
980253789 4:130350193-130350215 GAAGGAAAAAGGAAGGAGGGAGG - Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980473840 4:133284416-133284438 GAGGGTAGAAGGTAGGAGGAGGG - Intergenic
980795164 4:137673305-137673327 GAAGGAAAAAAAAAGGAGGGTGG - Intergenic
980894953 4:138853224-138853246 GAAGGAAAGAAGCAGGAGGGAGG + Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981334836 4:143558690-143558712 GAGCGCAAAAAATAGGAGGCTGG - Intergenic
981394295 4:144229083-144229105 GATGAAAAAAAGGAGGAGGGAGG + Intergenic
981498253 4:145417554-145417576 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982633097 4:157857259-157857281 GGGGAAAAAAAGTGGGAGGGAGG - Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
982903752 4:161042453-161042475 TAGGGCAGAAAGTTGGAGGGGGG - Intergenic
983076883 4:163337390-163337412 GAGGGTATGAGGTAGGAGGCTGG - Intronic
983167040 4:164490595-164490617 GAAGGTAAAAGGTAGGAAGCAGG + Intergenic
983580279 4:169302987-169303009 GAAGGTAAAAAAGAGGAGGCAGG + Intergenic
984086738 4:175322906-175322928 GAAGGTAGAAAGTAGGAGGAGGG + Intergenic
984326626 4:178262551-178262573 GAGGGAGAAAAGTAGGAAGCAGG + Intergenic
985327569 4:188789173-188789195 GAGGGTGGAAGGTAGGAGGTGGG - Intergenic
985446528 4:190023822-190023844 GAGGGAGAGAAGGAGGAGGGAGG - Intergenic
986229241 5:5846635-5846657 GAGGGTAAAAGGTAAGAGGAGGG - Intergenic
986346847 5:6843748-6843770 GAGGCTAAAAAGGAAGAGGACGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986896653 5:12379157-12379179 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
987619677 5:20324687-20324709 GAGGGTAAAATGTAGTAAGAAGG + Intronic
987725927 5:21699559-21699581 GAGGGTGAAGAGTGGGAGAGTGG - Intergenic
987891152 5:23880428-23880450 AAGGGGGAAAGGTAGGAGGGAGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988661582 5:33276017-33276039 GTGTTTAAAAAATAGGAGGGTGG + Intergenic
989455946 5:41644509-41644531 GTGGGTGAAAAGTGGGAGGAGGG + Intergenic
989513300 5:42313609-42313631 GAGGGTAGAGGGTAGGAGGGAGG - Intergenic
989981893 5:50655475-50655497 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
990782254 5:59378280-59378302 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
991964860 5:72080701-72080723 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
992220314 5:74565657-74565679 GAGGGCGTAAGGTAGGAGGGTGG - Intergenic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
992872766 5:81023079-81023101 GAGGGTAGAGGGTGGGAGGGAGG + Intronic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993695726 5:91059436-91059458 GAGGGTATAATGTAGGGGGAAGG - Intronic
994128907 5:96201590-96201612 TAGGGAAAAATGTAGGAGTGGGG - Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995662979 5:114506782-114506804 GAGGGTGGAAGGTGGGAGGGAGG + Intergenic
995691861 5:114835411-114835433 GAGGGTGGACGGTAGGAGGGAGG + Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
995746957 5:115414315-115414337 GGGGGTAGGAAGCAGGAGGGAGG + Intergenic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
997046623 5:130326725-130326747 GAGGGTAGAAGGTAGGAAGGAGG - Intergenic
997790910 5:136761196-136761218 GAGGGTGGAGGGTAGGAGGGGGG + Intergenic
998595669 5:143527328-143527350 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
998976028 5:147648896-147648918 GAGGGGAGAGAGTAGGAGGTAGG + Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999115004 5:149155178-149155200 GATGGTAAAAAGGAGGAGCAGGG - Intronic
999567383 5:152879829-152879851 GAGGGTGGAGGGTAGGAGGGGGG + Intergenic
999692680 5:154162345-154162367 GAGGGAAAAAAGTAGGGAGGAGG + Intronic
999728514 5:154457308-154457330 GAGGGTATGGGGTAGGAGGGTGG + Exonic
999751701 5:154632325-154632347 GAGGGAAGGAAGAAGGAGGGAGG - Intergenic
1000206783 5:159068348-159068370 AATGGTAAAAAGTATGTGGGTGG + Intronic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1000839088 5:166194133-166194155 AAAGGAAAAAATTAGGAGGGAGG - Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001402278 5:171452527-171452549 GAGGGTAGCAAGGAGAAGGGGGG - Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1002068957 5:176667425-176667447 AAGGATAAAAATTAGCAGGGAGG + Intergenic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1004470615 6:15925749-15925771 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005290384 6:24373838-24373860 GAAGGAAGAAAGTGGGAGGGAGG + Intergenic
1005336254 6:24799816-24799838 GAGGAGAAAAATTAGGAGTGTGG - Intronic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1006246868 6:32745127-32745149 GAAGGTGACAAGCAGGAGGGTGG - Intronic
1006260145 6:32861136-32861158 GAGGGTCAAAACTGGGAGAGGGG + Intergenic
1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG + Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008025233 6:46628634-46628656 CAGAGTACAAAGTAGGAGAGAGG + Intronic
1008025605 6:46632605-46632627 GAGGGTAGAGATTGGGAGGGGGG - Intronic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1008920383 6:56837764-56837786 GAAGGTGAAAAGTACCAGGGAGG - Intronic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009251586 6:61307551-61307573 CAGGACAAAAAGTAGAAGGGAGG - Intergenic
1009327193 6:62366579-62366601 GATGGTAAAAAAGAGGAGAGTGG - Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1010153333 6:72762301-72762323 GAGGTGAAAAGGGAGGAGGGAGG + Intronic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1010377377 6:75186969-75186991 GAGGGTTGAAGGTAGGAGGAGGG + Intronic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011245205 6:85314897-85314919 GAGGGTGAGAAGAAGCAGGGCGG - Intergenic
1011498175 6:87958391-87958413 TAGGTTAAAAATTAGAAGGGTGG - Intergenic
1011969712 6:93207905-93207927 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1012629777 6:101450784-101450806 GAAGGAAAAAGGTAGGAGAGAGG + Intronic
1012911403 6:105121939-105121961 GCAGGTAAAAAGTGTGAGGGTGG + Intronic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1013139075 6:107312740-107312762 GAGGGTAGAAGGAAGAAGGGAGG + Intronic
1013327612 6:109063271-109063293 AAGAGAAATAAGTAGGAGGGTGG + Intronic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013569994 6:111413007-111413029 AAGGGTGAAGAGTAAGAGGGAGG - Intronic
1013570027 6:111413287-111413309 GGGGGAAAAAAGTAGAATGGAGG + Intronic
1013682110 6:112535835-112535857 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1013788328 6:113807982-113808004 GAGGGTTAAGAATGGGAGGGAGG + Intergenic
1013937432 6:115615280-115615302 GAAGGTAAAAAAGGGGAGGGAGG + Intergenic
1014212339 6:118720180-118720202 GAGGGAAAAAGGAAGGAAGGAGG - Intergenic
1014472670 6:121835488-121835510 GAGGGTGGTGAGTAGGAGGGTGG + Intergenic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015463097 6:133516235-133516257 GAGGGTGAAGGGTAGGAGGAGGG + Intronic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015844152 6:137501131-137501153 GAGGGTGAAAAGAAAGAAGGAGG + Intergenic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1016331047 6:142952233-142952255 GATGGAAGAAAGTAGGATGGGGG - Intergenic
1018985904 6:168636965-168636987 GAGGGAGGAAAGCAGGAGGGAGG - Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019943427 7:4308674-4308696 AAGGTTAAAATGGAGGAGGGTGG - Intergenic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020080045 7:5282261-5282283 GATGGTAGAAGGGAGGAGGGAGG + Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020411546 7:7897145-7897167 GAGGGTAACATGGAAGAGGGTGG - Intronic
1020852113 7:13367495-13367517 GAGGGGAGAAGGTGGGAGGGAGG - Intergenic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021801537 7:24311628-24311650 GAGGGTAGAAAGTCTTAGGGTGG - Intergenic
1021962348 7:25885402-25885424 GAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1022043001 7:26598112-26598134 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022216060 7:28262784-28262806 GAAGGAAAGAAGGAGGAGGGAGG - Intergenic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1022431424 7:30326278-30326300 GAGGGTGGAGAGTAGGAGGAAGG - Intronic
1022594204 7:31696509-31696531 GAGGTGAGAAAGCAGGAGGGCGG + Intronic
1023083976 7:36551547-36551569 AAGGGCAGAAAGTAGGAGGGTGG - Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1024178141 7:46861785-46861807 GAGAGTTAAGAGGAGGAGGGTGG + Intergenic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1025067645 7:55871596-55871618 GAGGGTAGGAGGTAGGAGGAGGG + Intergenic
1025596846 7:62939900-62939922 GAGGATAAAAACTAGAAGGAAGG - Intergenic
1025614010 7:63102568-63102590 GAGGGAAAAAGCTAGGAAGGAGG - Intergenic
1025873470 7:65457399-65457421 GAGGGTGGAAGGTAGGAGGAGGG - Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1027726170 7:81808673-81808695 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1028323647 7:89494936-89494958 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1028342122 7:89734632-89734654 GAGGGTAGAGAGTTGGAGGAAGG + Intergenic
1028389737 7:90301471-90301493 GATGGTAGAGAGTAGGAGGAGGG - Intronic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1028913400 7:96232441-96232463 GAGGGTAGAAGGTGGGAGGAGGG + Intronic
1029139544 7:98400568-98400590 GAGGAGGAAAAGTAGGGGGGAGG + Intronic
1029204879 7:98863634-98863656 GAGGGAAGGAAGAAGGAGGGAGG - Intronic
1029451038 7:100641879-100641901 GAGGGGTAAAAGCAGGAGAGGGG - Intronic
1029745202 7:102512576-102512598 GAGGGAGAAGAGTAAGAGGGAGG + Intronic
1029763194 7:102611737-102611759 GAGGGAGAAGAGTAAGAGGGAGG + Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030560999 7:111085966-111085988 GAGGGTTAAGAGTGGGAGGAGGG + Intronic
1031136833 7:117893624-117893646 GGGGGGTAAAAGTGGGAGGGGGG - Intergenic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031317334 7:120273574-120273596 GAAGGTGAAAAGGAGGAGGGAGG + Intergenic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031592107 7:123605844-123605866 GAGGGTCGAAAGTGGGAGGAGGG + Intronic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1032194492 7:129781232-129781254 GAAGCTAAAAAGGAGAAGGGCGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032655946 7:133929714-133929736 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1032678676 7:134158890-134158912 GAGGGTAAGAAGTAGGAGAAAGG - Intronic
1032813010 7:135441976-135441998 AATGGTAAAAGGTAGGAGGAGGG + Intronic
1032996116 7:137448559-137448581 GAGGGAGAGAAGGAGGAGGGAGG + Intronic
1033099591 7:138459388-138459410 GAGGGAATAAAATAAGAGGGAGG + Intergenic
1033246257 7:139718820-139718842 GAGGGAAAGAATTAAGAGGGGGG - Intronic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033604835 7:142919276-142919298 GTGGATAAAAAGTAGGAGGGAGG - Intronic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034059347 7:148072142-148072164 CAGGGGTAAAGGTAGGAGGGAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1037100362 8:15036403-15036425 GAGGGTATAGAGTTGGAGGAGGG + Intronic
1037151248 8:15637828-15637850 GAGAGGAAGAAATAGGAGGGAGG - Intronic
1037447289 8:18978850-18978872 GAGGGTAGAGGGTAGGAGAGAGG - Intronic
1037617740 8:20534666-20534688 GAGGGTGAAAGGTGGGAGGAGGG - Intergenic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038423200 8:27447019-27447041 GAGAGTCAAAGGCAGGAGGGTGG - Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038629841 8:29231208-29231230 GATGCTTAAAAGTAGGATGGGGG - Intronic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039321630 8:36438147-36438169 GAGGGAGGAAAGTGGGAGGGAGG + Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040034733 8:42859251-42859273 CAGGGAAAAAAGTAGAAGTGAGG + Intronic
1040924261 8:52660240-52660262 GAGGCTGTAAAGGAGGAGGGAGG + Intronic
1041540348 8:58977727-58977749 GAGGGGGAAAAATAGGAGAGCGG + Intronic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1041773119 8:61494288-61494310 GAGGGTAGAATAAAGGAGGGTGG + Intronic
1042703990 8:71647396-71647418 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1042852024 8:73226080-73226102 GAGGTTAAAAACAAAGAGGGAGG + Intergenic
1043189177 8:77195405-77195427 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044350745 8:91163271-91163293 GAGGCTAAAAAAATGGAGGGTGG - Intronic
1044351264 8:91169252-91169274 GAGGGTAGAAAGTGGGAGGAGGG + Intronic
1044462240 8:92458827-92458849 GAGGGTAAAAGGTGGGTGGATGG + Intergenic
1044847775 8:96398882-96398904 GAGAGTGAAAAGGAGGAGGAGGG - Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045618201 8:103942135-103942157 GAGGGTAGAGGGTAGGAGGAGGG - Intronic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1045805867 8:106160765-106160787 GAGGGTAAGATGTAGTATGGGGG - Intergenic
1046188902 8:110763491-110763513 GAGGGTAGAAAGTGGGAGGAGGG + Intergenic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1046366573 8:113239650-113239672 ATGGGTAATGAGTAGGAGGGTGG + Intronic
1047131286 8:122022772-122022794 GAGGGGAGAAAGGAGGAGAGAGG - Intergenic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1047606568 8:126480496-126480518 GAAGGTGAAAAGTAGGAAGAAGG + Intergenic
1047646585 8:126876672-126876694 GAGGGAGGAAAGTAGGAAGGAGG + Intergenic
1047946569 8:129886820-129886842 GAGGGTAGCAAGAAGTAGGGAGG - Intronic
1048224488 8:132571541-132571563 GAGGGGAAGAAGGAGCAGGGAGG + Intergenic
1048535223 8:135287606-135287628 GGTGGTGAAAAGTAGGAGTGGGG + Intergenic
1048825635 8:138423115-138423137 GAGGGTAGAGAGTGGGAGGGGGG + Intronic
1049083166 8:140458028-140458050 GAGGGGTGAAAGAAGGAGGGAGG + Intronic
1049210764 8:141385445-141385467 GAAGGGAAAAAGAGGGAGGGAGG - Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1050366955 9:4881680-4881702 GAGGGAAGAAGGGAGGAGGGAGG - Intronic
1050397925 9:5219376-5219398 TGGGGTAAAAAGTGGGAGGGAGG + Intergenic
1050789412 9:9447513-9447535 GAGGGTAGGAAGTAAGAGGGAGG + Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053100533 9:35368202-35368224 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1053329177 9:37188523-37188545 GAGGGTAATAAGGAGGGGTGGGG - Intronic
1053557644 9:39154565-39154587 GAGGAGGAAAAGTAGTAGGGTGG + Intronic
1053607462 9:39675486-39675508 GGGTGTAAAAAGTGGGAGGTGGG - Intergenic
1053821759 9:41974853-41974875 GAGGAGGAAAAGTAGTAGGGTGG + Intronic
1053865311 9:42431844-42431866 GGGGGTAAAAAGTGGGAGGTGGG - Intergenic
1054139470 9:61464386-61464408 GAGGAGGAAAAGTAGTAGGGTGG - Intergenic
1054246073 9:62666923-62666945 GGGTGTAAAAAGTGGGAGGTGGG + Intergenic
1054259673 9:62850533-62850555 GAGCTGAAAAAGTAGGAGGTTGG - Intergenic
1054560195 9:66701456-66701478 GGGTGTAAAAAGTGGGAGGTGGG + Intergenic
1054608811 9:67212555-67212577 GAGGAGGAAAAGTAGTAGGGTGG - Intergenic
1055112526 9:72573933-72573955 GAGGGTGGAAAGTAGGAGGAGGG - Intronic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055711832 9:79071742-79071764 CAGGGTAAATGGTGGGAGGGGGG + Intergenic
1055782753 9:79837188-79837210 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1056300063 9:85231445-85231467 TGGGGTGAACAGTAGGAGGGGGG + Intergenic
1056986575 9:91369123-91369145 GAGGGTTAAAAGCAATAGGGTGG - Intergenic
1057002123 9:91519641-91519663 GAAGGAAAAAAACAGGAGGGAGG + Intergenic
1057813876 9:98279729-98279751 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058196838 9:101987363-101987385 GAGGGTGGAAGGTAGGAGGATGG - Intergenic
1058850765 9:109010125-109010147 GAGGCTAAAAAATGGGAGGATGG - Intronic
1058959946 9:109983430-109983452 GAGGAAAAAAAGGAGGAGTGGGG - Intronic
1059431533 9:114253417-114253439 GAGGAGAAAAAAGAGGAGGGAGG + Intronic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060675433 9:125510167-125510189 AAAGGTAAAAAGTAGGAAGGGGG + Intronic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061928803 9:133821663-133821685 GAGACTAAAAAGTTGGATGGGGG + Intronic
1062050638 9:134444754-134444776 GAAGGAGAAAAGAAGGAGGGAGG - Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186238523 X:7541104-7541126 TGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1186330972 X:8533999-8534021 GAGGGAAGAATGAAGGAGGGAGG + Intronic
1186946456 X:14573817-14573839 GAGGATATAAAGAAGGAGTGGGG + Intronic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187328024 X:18309771-18309793 GAGGGTGGAAGGTAGGAGGAGGG + Intronic
1187607328 X:20899913-20899935 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1187756432 X:22532179-22532201 GAGGGTAGAAGGTGGGAGGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188466100 X:30483066-30483088 GAAGGTAGAAAGTAGCATGGTGG + Intergenic
1188726566 X:33591367-33591389 GAGGGTGGAAGGTAGGAGGAGGG + Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1188969130 X:36591682-36591704 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1191088102 X:56590825-56590847 GAGGGTAGAAGGTGGGAGGAGGG - Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1192028794 X:67486759-67486781 GAGGGTAAGAAATAAGAGGAGGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193562581 X:83037636-83037658 GAGGGTGAGCAGTAGCAGGGTGG + Intergenic
1193701643 X:84769904-84769926 GAGGGTAAAAAGGAGGTGGTAGG - Intergenic
1194022355 X:88707672-88707694 GAGGGTAGAAAGTGAGAGGAGGG - Intergenic
1194411881 X:93567751-93567773 GGGGGGAAGAAGTGGGAGGGGGG - Intergenic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1195207649 X:102619086-102619108 GAGGGTTGAAGGTAGGAGTGGGG - Intergenic
1195863517 X:109406348-109406370 AAGGGTGAAAACTAGGAGGTAGG + Intronic
1196540752 X:116904080-116904102 GAGGTTGAAAAGTGGGAGGAGGG + Intergenic
1197498879 X:127220091-127220113 GAGGGTGGAAAGTTGGAGGAAGG - Intergenic
1197571315 X:128154159-128154181 GAGACTCAGAAGTAGGAGGGTGG + Intergenic
1197862596 X:130986337-130986359 GAGGGTAGAGAGTTGGAGGAGGG - Intergenic
1198310778 X:135424720-135424742 GAGGGTACATAGTAGGTGGCTGG - Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1198743682 X:139867685-139867707 CAGGCTAAGAAGTAAGAGGGAGG + Intronic
1198778754 X:140210709-140210731 GAGGGTGAAGCGTAGGAGGAGGG + Intergenic
1198885365 X:141329666-141329688 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1199330052 X:146548975-146548997 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201409082 Y:13680669-13680691 GAGGGTGAGAAGAAGTAGGGTGG + Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1201985522 Y:19960651-19960673 GAGCCTAAAAAAGAGGAGGGAGG + Intergenic