ID: 1008376201

View in Genome Browser
Species Human (GRCh38)
Location 6:50794953-50794975
Sequence CCAGCTGGTCACATTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008376201_1008376207 -2 Left 1008376201 6:50794953-50794975 CCCATAAAAATGTGACCAGCTGG No data
Right 1008376207 6:50794974-50794996 GGGAGAAAATGGAGTCCCCATGG No data
1008376201_1008376209 11 Left 1008376201 6:50794953-50794975 CCCATAAAAATGTGACCAGCTGG No data
Right 1008376209 6:50794987-50795009 GTCCCCATGGAGCTTTGGAAAGG No data
1008376201_1008376208 6 Left 1008376201 6:50794953-50794975 CCCATAAAAATGTGACCAGCTGG No data
Right 1008376208 6:50794982-50795004 ATGGAGTCCCCATGGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008376201 Original CRISPR CCAGCTGGTCACATTTTTAT GGG (reversed) Intergenic
No off target data available for this crispr