ID: 1008376207

View in Genome Browser
Species Human (GRCh38)
Location 6:50794974-50794996
Sequence GGGAGAAAATGGAGTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008376201_1008376207 -2 Left 1008376201 6:50794953-50794975 CCCATAAAAATGTGACCAGCTGG No data
Right 1008376207 6:50794974-50794996 GGGAGAAAATGGAGTCCCCATGG No data
1008376197_1008376207 28 Left 1008376197 6:50794923-50794945 CCGGAAGGCTAATTGATAGGAAG No data
Right 1008376207 6:50794974-50794996 GGGAGAAAATGGAGTCCCCATGG No data
1008376203_1008376207 -3 Left 1008376203 6:50794954-50794976 CCATAAAAATGTGACCAGCTGGG No data
Right 1008376207 6:50794974-50794996 GGGAGAAAATGGAGTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008376207 Original CRISPR GGGAGAAAATGGAGTCCCCA TGG Intergenic
No off target data available for this crispr