ID: 1008378546 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:50818901-50818923 |
| Sequence | ATGGCAGCCTGGTCTCTAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 148 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 139} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008378546_1008378551 | -3 | Left | 1008378546 | 6:50818901-50818923 | CCTCCTAGAGACCAGGCTGCCAT | 0: 1 1: 0 2: 1 3: 7 4: 139 |
||
| Right | 1008378551 | 6:50818921-50818943 | CATCATGCTCTGGAAGCTTGTGG | 0: 1 1: 0 2: 1 3: 9 4: 149 |
||||
| 1008378546_1008378552 | 27 | Left | 1008378546 | 6:50818901-50818923 | CCTCCTAGAGACCAGGCTGCCAT | 0: 1 1: 0 2: 1 3: 7 4: 139 |
||
| Right | 1008378552 | 6:50818951-50818973 | CAAGTACGAAGATATCTATGAGG | 0: 1 1: 0 2: 0 3: 3 4: 72 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008378546 | Original CRISPR | ATGGCAGCCTGGTCTCTAGG AGG (reversed) | Exonic | ||