ID: 1008378546

View in Genome Browser
Species Human (GRCh38)
Location 6:50818901-50818923
Sequence ATGGCAGCCTGGTCTCTAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008378546_1008378551 -3 Left 1008378546 6:50818901-50818923 CCTCCTAGAGACCAGGCTGCCAT 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1008378551 6:50818921-50818943 CATCATGCTCTGGAAGCTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1008378546_1008378552 27 Left 1008378546 6:50818901-50818923 CCTCCTAGAGACCAGGCTGCCAT 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1008378552 6:50818951-50818973 CAAGTACGAAGATATCTATGAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008378546 Original CRISPR ATGGCAGCCTGGTCTCTAGG AGG (reversed) Exonic