ID: 1008378551

View in Genome Browser
Species Human (GRCh38)
Location 6:50818921-50818943
Sequence CATCATGCTCTGGAAGCTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008378546_1008378551 -3 Left 1008378546 6:50818901-50818923 CCTCCTAGAGACCAGGCTGCCAT 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1008378551 6:50818921-50818943 CATCATGCTCTGGAAGCTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1008378547_1008378551 -6 Left 1008378547 6:50818904-50818926 CCTAGAGACCAGGCTGCCATCAT 0: 1
1: 0
2: 2
3: 29
4: 178
Right 1008378551 6:50818921-50818943 CATCATGCTCTGGAAGCTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1008378543_1008378551 29 Left 1008378543 6:50818869-50818891 CCAGACATCTGCTCCTCACATGA 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1008378551 6:50818921-50818943 CATCATGCTCTGGAAGCTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1008378544_1008378551 16 Left 1008378544 6:50818882-50818904 CCTCACATGAATGCACTCACCTC 0: 1
1: 0
2: 1
3: 19
4: 191
Right 1008378551 6:50818921-50818943 CATCATGCTCTGGAAGCTTGTGG 0: 1
1: 0
2: 1
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008378551 Original CRISPR CATCATGCTCTGGAAGCTTG TGG Exonic