ID: 1008378552

View in Genome Browser
Species Human (GRCh38)
Location 6:50818951-50818973
Sequence CAAGTACGAAGATATCTATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008378547_1008378552 24 Left 1008378547 6:50818904-50818926 CCTAGAGACCAGGCTGCCATCAT 0: 1
1: 0
2: 2
3: 29
4: 178
Right 1008378552 6:50818951-50818973 CAAGTACGAAGATATCTATGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1008378549_1008378552 16 Left 1008378549 6:50818912-50818934 CCAGGCTGCCATCATGCTCTGGA 0: 1
1: 0
2: 2
3: 24
4: 313
Right 1008378552 6:50818951-50818973 CAAGTACGAAGATATCTATGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1008378546_1008378552 27 Left 1008378546 6:50818901-50818923 CCTCCTAGAGACCAGGCTGCCAT 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1008378552 6:50818951-50818973 CAAGTACGAAGATATCTATGAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1008378550_1008378552 8 Left 1008378550 6:50818920-50818942 CCATCATGCTCTGGAAGCTTGTG 0: 1
1: 0
2: 1
3: 19
4: 173
Right 1008378552 6:50818951-50818973 CAAGTACGAAGATATCTATGAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008378552 Original CRISPR CAAGTACGAAGATATCTATG AGG Exonic