ID: 1008379228

View in Genome Browser
Species Human (GRCh38)
Location 6:50823547-50823569
Sequence TCTGGTGGTAGGGGAGCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008379228 Original CRISPR TCTGGTGGTAGGGGAGCGGC TGG (reversed) Exonic
900683677 1:3933084-3933106 TCTGGTGGCATGTGAGGGGCAGG + Intergenic
901841868 1:11958596-11958618 TCTGGGGGTAGTGGAGCCGCAGG - Exonic
902383649 1:16064450-16064472 TCTGGGGGGAGGGCAGGGGCAGG - Intronic
902414102 1:16228945-16228967 TCTGGTGGGTGGGGAGAAGCAGG - Intergenic
902813724 1:18904217-18904239 TCTGGTGTTGGGGGAGGGGTAGG - Intronic
902878060 1:19352913-19352935 GCTGGTGGTAGGCCAGTGGCCGG - Intronic
903328869 1:22586726-22586748 TCTGCTGGTGGGGCAGGGGCGGG + Intronic
903579874 1:24362791-24362813 TCTTGTGGTGGAGGAGCAGCTGG + Intronic
905120812 1:35680422-35680444 TCAGGTGATGTGGGAGCGGCAGG - Intergenic
905140769 1:35842312-35842334 GATGAGGGTAGGGGAGCGGCGGG - Intronic
905259164 1:36705462-36705484 TCTGGTGGTTGGGGAGGCGTGGG + Intergenic
906400300 1:45499611-45499633 TCCTGTGGCAGGGGAGCGGCAGG + Exonic
907077970 1:51595193-51595215 CCAGGTGTTAAGGGAGCGGCAGG + Intronic
911651962 1:100398944-100398966 TCTGGTGGTAGGGGAGTGAAGGG + Intronic
912390560 1:109299840-109299862 TCTGGTGGCTTGGGAGGGGCGGG + Intronic
912443546 1:109716353-109716375 GGTGGTGGGAGGGGAGCGGTGGG + Intronic
914070345 1:144281130-144281152 TCTGGAGGTAGGGGATGGGTGGG + Intergenic
914108810 1:144685224-144685246 TCTGGAGGTAGGGGATGGGTGGG - Intergenic
915943551 1:160134317-160134339 TCTGTGGGCAGGGGAGTGGCTGG - Intronic
916714481 1:167438106-167438128 CCTGTGGGTAGGGGAGCAGCTGG - Intronic
917628712 1:176872357-176872379 TCTGGTGGTAGGAGACAGTCAGG + Intronic
917974157 1:180228949-180228971 GCTGGGGGCAGGAGAGCGGCTGG + Intergenic
919654015 1:200180271-200180293 CATGGTGGCAGGGGAGCGGGAGG - Intergenic
919662492 1:200260848-200260870 TGTGGTGGGAGGGGAGAGGAGGG + Intergenic
919923174 1:202178202-202178224 TCTGGTGGTGGCAGAGCAGCTGG + Intergenic
920548004 1:206834784-206834806 TCTGGTGTCAGGGGAGCTACTGG + Intronic
922887230 1:229029320-229029342 TCTGGTGGGAGGAGATGGGCAGG + Intergenic
1064355524 10:14614343-14614365 TTTAGTGGTCGGGGAGCTGCTGG + Intronic
1069622449 10:69846263-69846285 TCTGGTGGCACTGGAGGGGCTGG + Intronic
1070630962 10:78084392-78084414 CCAGGTGGTAGGAGAGCTGCAGG + Intergenic
1071815466 10:89227935-89227957 TCTGGTGGTGTGGGTGCTGCTGG - Intronic
1072656805 10:97335104-97335126 CCTGGTCGTGGGGGAGGGGCGGG + Intergenic
1073400159 10:103250870-103250892 GGTGGTGGTAGTGGAGTGGCAGG - Intergenic
1074692972 10:116023683-116023705 TATGGTGGCAGGGGAGAGGCTGG - Intergenic
1075626788 10:123969610-123969632 TCTAGGGGTAGGGGGGCGGGGGG + Intergenic
1075676760 10:124301241-124301263 TCTGGTCCTAGGGGAGCCCCTGG + Intergenic
1077077164 11:706995-707017 CCTGGTGGCAGGGGAGGGGGAGG + Intronic
1077225940 11:1439225-1439247 GCTGGGGGAAGGGGAGCTGCTGG - Intronic
1077445330 11:2588054-2588076 GGTGGTGGGAGGGGAGCAGCAGG + Intronic
1077942020 11:6852800-6852822 TCTTGTGGTAGGGGCATGGCAGG + Intergenic
1078771629 11:14357986-14358008 GCTGGGGGTAGGGGAGAGGGTGG + Intronic
1079317581 11:19422227-19422249 TCTGGGGGGCGGGGAGCGGGTGG + Intronic
1080019330 11:27543701-27543723 TCTGGTGGGAGGGGCCCGGTTGG - Intergenic
1080174996 11:29352431-29352453 TCTGGTGGTGGGGGATGGGTGGG - Intergenic
1083261987 11:61528185-61528207 GCTGGGGGTGGGGGAGAGGCCGG + Exonic
1083263992 11:61537760-61537782 TCTGGTGGTTGGTGGGCGGGGGG - Intronic
1083905011 11:65663434-65663456 TGTGGGGGAATGGGAGCGGCCGG + Intergenic
1083980029 11:66159603-66159625 TTTGGGGGTGGGGGAGCGGGTGG + Intronic
1089364826 11:117915318-117915340 GCTGGTGGAGGAGGAGCGGCAGG - Intronic
1090064484 11:123491457-123491479 GCTGGGGGAAGGGGAGGGGCAGG - Intergenic
1092137245 12:6158679-6158701 TCTGGTGGCAGGGGAGGGGCTGG - Intergenic
1095984702 12:47991544-47991566 TCTGATGGGAGGGGAGAGGGAGG + Intronic
1095991350 12:48036810-48036832 ACTGGTGGTAGGGGTGAGGAAGG - Intergenic
1100021712 12:90076832-90076854 TCTGGTGGTAGGGGAAAGCGTGG - Intergenic
1101873527 12:108583827-108583849 TCTGGGGGAAGAGGAGAGGCAGG + Intergenic
1104123873 12:125825250-125825272 TTTGGGGGTAGGGGAGGGGAGGG + Intergenic
1104734164 12:131126626-131126648 TCTGGTGGGAGGAGGGAGGCAGG - Intronic
1104735551 12:131133971-131133993 TCTTGGGGTAGGGGGGTGGCAGG - Intronic
1104785769 12:131447165-131447187 TGTGGTGGGAGGGGTGCAGCGGG + Intergenic
1105223291 13:18354225-18354247 TCTGGAGGTAGGGGATGGGTAGG - Intergenic
1105442984 13:20430635-20430657 TCTGGTGTAAGGGGATCGGGTGG - Intronic
1106112265 13:26787360-26787382 GCTGGTGGTGGAGGAGCAGCTGG - Intergenic
1109219533 13:59627299-59627321 TTTGGTGGTAGGGGTGGGGTGGG + Intergenic
1110558599 13:76886608-76886630 GCTGGTGGGTGGGGAGCGGGTGG - Intergenic
1110718117 13:78730956-78730978 TTTGGTGGTAGGGGTGGGGGTGG + Intergenic
1111996125 13:95167788-95167810 TCTGCTGTTAGGGAAGGGGCTGG + Intronic
1112508949 13:99991618-99991640 CCTGGTGGTAGGGGGGAGACTGG - Intergenic
1113542818 13:111122213-111122235 GCTGCTGGTTGGGGAGCGGGAGG + Intronic
1118312326 14:64703340-64703362 TCTACTGGGAGGGGAGAGGCGGG - Intergenic
1119180315 14:72600830-72600852 GCTGGTGGTGGGGATGCGGCAGG - Intergenic
1121612725 14:95292666-95292688 GCTGGTGGTAGGGGAGGGTGGGG + Intronic
1121950610 14:98167846-98167868 ACTGGTGGGAGGGCAGGGGCAGG - Intergenic
1122372616 14:101237009-101237031 GCTGGTGGTAGGTGAGTGCCAGG + Intergenic
1122881255 14:104691471-104691493 GATGGAGGTAGGGGAGGGGCTGG - Intronic
1122901061 14:104782516-104782538 TCTGGGGGTGCGGGAGGGGCAGG + Intronic
1122919337 14:104873648-104873670 TCTGAGGCTAGGGGAGCAGCAGG + Intronic
1124507526 15:30291295-30291317 TCTGGTGGTAGGTGTGGGGTTGG + Intergenic
1124736029 15:32247363-32247385 TCTGGTGGTAGGTGTGGGGTTGG - Intergenic
1124970962 15:34489646-34489668 TCGGGTGGTGGGGGAGGGGGTGG + Intergenic
1125512634 15:40301046-40301068 GCTGGCTGTAGGGGAGCCGCAGG + Intronic
1126615434 15:50574053-50574075 TCTGGGGGTGGGGGAGGGGGCGG + Intronic
1128511362 15:68315832-68315854 GCTGGGGGTTGGGGAGCTGCTGG + Intronic
1129423638 15:75450468-75450490 GGTGATGGTAGGGGAGGGGCAGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130270727 15:82445615-82445637 TCTGGCGGGAGGGGCGCGGAAGG - Intergenic
1130463072 15:84172938-84172960 TCTGGCGGGAGGGGCGCGGAAGG - Intronic
1130489603 15:84421850-84421872 TCTGGCGGGAGGGGCGCGGAAGG + Intergenic
1130501193 15:84500612-84500634 TCTGGCGGGAGGGGCGCGGAAGG + Intergenic
1130508713 15:84570713-84570735 TCTGGCGGGAGGGGCGCGGAAGG + Intergenic
1131570100 15:93525940-93525962 TCAGGGGGTAGGGGAGAGGAGGG - Intergenic
1132904516 16:2275599-2275621 TCTGGTGGGAGAGAAGCTGCTGG - Intergenic
1134164148 16:11916271-11916293 CCTGGTGGGGGGGCAGCGGCAGG + Intergenic
1134425974 16:14145491-14145513 ACTGATGATAGTGGAGCGGCAGG + Intronic
1134677434 16:16100348-16100370 GCTGCTGGTAGGAGAGCGGGGGG + Intronic
1136039763 16:27568948-27568970 TCAGGTGGGAGGGGAGTGGTGGG - Intronic
1137977337 16:53042586-53042608 TCTGGTGGTGGGGGACGGGGAGG - Intergenic
1139234809 16:65326529-65326551 TCTGCTGGTCGGGGGGCGGCGGG - Intergenic
1139896149 16:70289376-70289398 TGCGGTGCTAGGAGAGCGGCTGG - Intronic
1140479040 16:75252665-75252687 CCTGGTGGCAGGGAAGCAGCGGG + Intronic
1141964129 16:87430214-87430236 TTTGGTGTAAGGGCAGCGGCGGG + Intronic
1142399569 16:89852165-89852187 TCTGGTGGGTGGGGAGAGGATGG - Intronic
1142399614 16:89852282-89852304 TCTGGTGGGTGGGGAGAGGATGG - Intronic
1142399677 16:89852438-89852460 TCTGGTGGGTGGGGAGAGGATGG - Intronic
1142715066 17:1742798-1742820 CCTGGTGGGAGGGGAGGGGTGGG + Intergenic
1142900339 17:3007735-3007757 CCTGGTGGTAGAGGAGCAGAAGG - Intronic
1143583616 17:7840235-7840257 TTTGGTAGTAGTGGAGAGGCTGG - Intronic
1144952153 17:19000160-19000182 CCTGGGGCTAGGGGAGGGGCAGG + Intronic
1145790686 17:27624837-27624859 TCTGGTGCTAGGGAAGGGGCTGG - Exonic
1147258213 17:39194660-39194682 CCTGGTGCTGGGGGAGGGGCCGG + Intronic
1147385304 17:40077624-40077646 TCAGGTGGCAGGGGAGGGGCAGG - Intronic
1147915156 17:43881446-43881468 ACTGGTGGCAGGTGAGCTGCGGG - Exonic
1148053238 17:44779481-44779503 CCTGGTGGCAGGGGAGGGCCTGG - Intronic
1149302631 17:55318906-55318928 GCTGGAGGCAGGGGAGAGGCTGG - Intronic
1149686211 17:58536726-58536748 GCTGCTGTTAGGGGAGCAGCAGG - Intronic
1151560590 17:74867571-74867593 TCTGGGGAAAGGGGAGCAGCAGG + Intronic
1152207328 17:78981127-78981149 TCTGGGAGTAGGGGACAGGCAGG + Intergenic
1152218571 17:79048583-79048605 TCTGGGGTCAGGGGAGGGGCCGG + Exonic
1152236456 17:79141554-79141576 TCAGGTGGTTGGGGTGGGGCTGG + Intronic
1152960242 18:75553-75575 TCTGGAGGTTGGGGACTGGCAGG - Intergenic
1153285393 18:3450980-3451002 GCTGGGAGTAGGGGGGCGGCGGG - Intronic
1153778678 18:8475948-8475970 TCTGTTGGTTGGGGAGCAGGTGG + Intergenic
1153975805 18:10267647-10267669 TCTGGTGGGAGAGGAATGGCGGG + Intergenic
1157103138 18:44748114-44748136 TCTAGTGGGAGGGGAGCAGGAGG - Intronic
1157209081 18:45725916-45725938 TTTGGTGGTAGAGGAAAGGCCGG + Intronic
1159334256 18:67043558-67043580 TGTGGGGGTAGGGGAGCTTCCGG - Intergenic
1160791576 19:925960-925982 TCTGGGGGTGGGGGAGGGGCGGG + Intronic
1161085476 19:2333077-2333099 TCTGCTGGGAGGGGAGCAGGAGG + Intronic
1161085514 19:2333198-2333220 TCTGCTGGGAGGGGAGCAGGAGG + Intronic
1161085533 19:2333258-2333280 TCTGCTGGGAGGGGAGCAGGAGG + Intronic
1161253507 19:3293803-3293825 TCTGGGGGTGGGGGTGCGGTGGG + Intronic
1161818461 19:6515098-6515120 TCTGGTGACAGTGGAGTGGCTGG + Intergenic
1162289793 19:9770240-9770262 TCTGGGGGTGGGGGTGGGGCTGG - Intronic
1162725870 19:12689482-12689504 GATGGAGGTAGGGGAGAGGCAGG + Intronic
1164777309 19:30862916-30862938 TTTGGTGCTAGGGAAGCGTCAGG + Intergenic
1165849309 19:38840208-38840230 TCGGGTGGTGGGGGAGGGGGTGG + Exonic
1166355742 19:42226234-42226256 TCTGGAGGTGGGGGTGGGGCAGG - Exonic
1167586975 19:50380814-50380836 GGTGGTGGCAGAGGAGCGGCTGG - Intronic
1167606261 19:50482415-50482437 TCTGCTGGCAGAGGAGCAGCTGG + Exonic
1168165992 19:54548416-54548438 TCTGGGGGTAGGGGAAGGGGAGG - Intergenic
926047970 2:9724215-9724237 TCTGGAGGAAGGAGAGCGTCAGG - Intergenic
927240254 2:20914718-20914740 TCTGGTGGTAAGAGAAAGGCAGG + Intergenic
928469440 2:31559091-31559113 TCTGGTGTCAGGGTAGCTGCTGG - Intronic
928683842 2:33728194-33728216 ACTGGTGGAAGGAGAGGGGCGGG - Intergenic
929364265 2:41133343-41133365 TGAGGTGGTAGGGGAGAAGCAGG + Intergenic
931487081 2:62705083-62705105 TATGTTGGGCGGGGAGCGGCCGG + Intronic
932696912 2:73964682-73964704 TCTGGTGGCAGGGGTGGGGCAGG - Intergenic
932773514 2:74514399-74514421 GCTGGGGGTAGGGCAGGGGCGGG - Intronic
933223380 2:79716656-79716678 TCTGGTGGTCAGGGAGCTCCAGG + Intronic
934180646 2:89616490-89616512 TCTGGAGGTAGGGGATGGGTGGG + Intergenic
934290946 2:91690749-91690771 TCTGGAGGTAGGGGATGGGTGGG + Intergenic
936080996 2:109432439-109432461 CCTGGGGATAGGGGACCGGCCGG - Intronic
938402638 2:131005678-131005700 TCAGGTGGGAGGGGAGGGGCGGG + Intronic
941289471 2:163657675-163657697 TGTGGTGGTAGGAGGGAGGCAGG + Intronic
942597071 2:177601419-177601441 TGTGGTGGTCGGGGGGCGGGGGG + Intergenic
945434975 2:209808896-209808918 CCTGGTGGTAGGGCTGCTGCTGG - Intronic
946304403 2:218847545-218847567 TCTGGGGATAGGGGAGTGGGGGG - Intergenic
948116936 2:235500336-235500358 TCGGGAGGTATGGGAGGGGCCGG - Intronic
949035210 2:241813037-241813059 ACTGGTGGTGGGGGAGCGGCAGG + Intronic
1168775257 20:441897-441919 GCTGGTGGTAGGCGAGAGGCTGG - Exonic
1168898183 20:1338244-1338266 ACTGGGGGCAGGGGAGCGGAAGG + Intronic
1169028677 20:2391330-2391352 TCTGGTGGCAGGGCCGAGGCAGG + Intronic
1173656412 20:44703134-44703156 TCTGGGGCTAGGGGAGCTGATGG + Intergenic
1173848283 20:46201587-46201609 TGTGGTGTTAGAGGAGGGGCGGG + Intronic
1173880259 20:46406510-46406532 CCTGGGGGTCGGGGCGCGGCAGG - Intronic
1174285302 20:49468646-49468668 GGTGGTGGTAGGGGGGCGGGGGG + Intronic
1174587332 20:51619155-51619177 TCTGGTGGCAGGGGAGGGGAGGG - Intronic
1175133779 20:56808264-56808286 TCAGGTGGGAGGGAGGCGGCTGG + Intergenic
1175442436 20:59001338-59001360 GCTGGTGGCTGGGGAGCTGCGGG - Intronic
1175651426 20:60727874-60727896 TCTGGTGGTAAGAGAGGGGCAGG - Intergenic
1176161837 20:63652468-63652490 TCTGGACGCAGGGGAGCTGCCGG - Intronic
1176731842 21:10506660-10506682 TCTGGAGGTAGGGGATGGGTAGG - Intergenic
1178638559 21:34327218-34327240 TCTGGGGGTTGGGGAGCAGGAGG + Intergenic
1179630467 21:42674689-42674711 GCTGGTGGTAGGAGAGAGGAAGG - Intronic
1179630471 21:42674707-42674729 TCTGGGGGTAGGAGAGAGGCTGG - Intronic
1180094471 21:45549671-45549693 ACAGGTGGTGGGGGAGGGGCAGG + Intergenic
1180626793 22:17199115-17199137 TCTGGTGGAGGGGGAGGGGGAGG - Intronic
1180869816 22:19139789-19139811 TGTGGTGGTTGGGGAGCCCCAGG - Intronic
1183094057 22:35541529-35541551 TCTGGGGGAAGTGGAGCAGCCGG + Intronic
1183333322 22:37232803-37232825 TCTGTGGATAGGAGAGCGGCCGG + Exonic
1183454916 22:37917373-37917395 CCTGGTGGCAGGGAAGCTGCTGG + Intronic
1184034886 22:41913671-41913693 TGTGGGGGCAGGGGAGAGGCAGG + Intronic
1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG + Intergenic
1185367034 22:50441503-50441525 TCCCGTGGAAGGGGAGCAGCAGG - Intronic
1185368037 22:50445902-50445924 TCAGGTGGGAGGCGAGCAGCAGG - Exonic
949876790 3:8631492-8631514 CCTGCTGGGAGGGGAGCAGCAGG + Intronic
950409414 3:12825588-12825610 TCTCCTGGTAGAGGAGGGGCAGG - Exonic
951558606 3:23945179-23945201 GCGGGAGGGAGGGGAGCGGCGGG + Intronic
953450440 3:43001088-43001110 TCTGGTGGACAGGGAGGGGCAGG - Intronic
953929491 3:46998884-46998906 GCTGGAGGTTGGGGAGCGGGAGG + Intronic
954108376 3:48421092-48421114 TCAGGTGGTTGGGGAGTGGGAGG + Intronic
954687703 3:52379571-52379593 TTTGGGGTTAGGGGAGCGACAGG + Intronic
955576227 3:60366664-60366686 TCTCATGGCAGGGGAGCGGACGG - Intronic
955910645 3:63856261-63856283 TGTGGTGGCAGGGGAGGGGCGGG + Intronic
957387637 3:79518001-79518023 TCTGGTGGTAAGAGAGCGGAAGG + Intronic
961359317 3:126357218-126357240 TCAGGTGGGAGAGGCGCGGCGGG - Exonic
963851359 3:150213595-150213617 TCTGGAGGTAGAGGAGCTGGAGG - Intergenic
965388195 3:168071535-168071557 CCTGGAGGTAGGGGGGCGCCGGG - Intronic
965820220 3:172677632-172677654 GCTGTTGGTGGGGGAGGGGCGGG + Intronic
966238658 3:177730271-177730293 CCTGGGGGTTGGGGAGCGGGTGG + Intergenic
968286442 3:197511842-197511864 CCTGGTGGAAGGGGAGGGGAGGG - Exonic
968585673 4:1414897-1414919 TCTGGGGGGAGGGCAGCTGCGGG - Intergenic
969537038 4:7762717-7762739 GCTGGAGGAAGGGGAGGGGCAGG + Exonic
969666129 4:8558439-8558461 TCTGGGGGCAGTGGAGAGGCGGG + Intergenic
969938719 4:10708710-10708732 TCTGGTGGTAGGGTACAGGAAGG + Intergenic
971898390 4:32625858-32625880 TGTGGAGGAAGGGGAGGGGCTGG + Intergenic
975826044 4:78320410-78320432 TCTGGTGGGAGGAGAGGTGCTGG + Intronic
980152239 4:129061649-129061671 TCTGGTGGTGGGGGCGTGGATGG + Intronic
980751489 4:137095768-137095790 GGTGGTGGTAGGGGAGTGGAAGG + Intergenic
982106266 4:152014424-152014446 TGTGGTGGCAGGGGCGGGGCTGG + Intergenic
984785882 4:183566919-183566941 GCTGGTGGTGGGGAAGCAGCTGG - Intergenic
985432717 4:189896858-189896880 TGTGATGGTAGGGGGGTGGCAGG + Intergenic
985657983 5:1142048-1142070 TCTGGTGCTAGAGGCGGGGCAGG + Intergenic
987920230 5:24271110-24271132 TGTGGTGGTAGGGGCGGGGGTGG - Intergenic
988517020 5:31913931-31913953 GCTGGGGGTAGGGGAGAGGTTGG - Intronic
989571599 5:42951132-42951154 GCCGGTGGCAGGGGAGCTGCCGG - Intergenic
990478931 5:56188350-56188372 TTTGGTTGTAGGGGGGTGGCGGG - Intronic
992783677 5:80150311-80150333 TCTGGTTGGGGGTGAGCGGCAGG + Intronic
994073239 5:95623903-95623925 TCTGGTGGTAGGGCTGTGCCAGG + Intergenic
998158391 5:139799213-139799235 TCTGGAGGTAGGGAAGGGGGAGG - Intronic
1000214991 5:159146718-159146740 GCTGGTTTTGGGGGAGCGGCGGG + Intergenic
1001253929 5:170169384-170169406 TCGGGTGGCAGGTGAGCCGCTGG + Intergenic
1001959374 5:175871230-175871252 TCTGGTTGCAGGGAGGCGGCAGG + Intronic
1002640800 5:180629767-180629789 GCTGCTGGTAGGGGAGAAGCTGG - Exonic
1005943235 6:30577024-30577046 CTTGGTGGTGGGGGAGAGGCTGG - Intronic
1006091637 6:31632079-31632101 CCTGGTGGTGGGGGAGCGAGAGG - Exonic
1007626021 6:43246847-43246869 TCTTAGGGTAGGGGAGCGGAGGG - Intronic
1007781092 6:44255201-44255223 TGTGGTGGCTGGGGAGCTGCGGG + Exonic
1008379228 6:50823547-50823569 TCTGGTGGTAGGGGAGCGGCTGG - Exonic
1008541488 6:52550214-52550236 TGTGGTTGAAGGGGAGGGGCTGG - Intronic
1009463715 6:63945367-63945389 TGTTGTGGGAGGGGACCGGCGGG - Intronic
1011640224 6:89411499-89411521 TCTGGCGGTTGGGGAGGGGAGGG - Intronic
1011740099 6:90350875-90350897 TCTGGTGGCAGAGGAGAGGGAGG - Intergenic
1013767827 6:113594974-113594996 TCTGCTGGTAGAGGAGCTGTAGG - Intergenic
1015614487 6:135060883-135060905 TCTGGTGGTAGAGAGGTGGCAGG - Intronic
1017169350 6:151441566-151441588 TCTGGTGGACGGAGAGGGGCTGG + Intronic
1018966350 6:168492759-168492781 TGTGGTGGTGGGAGAGCGTCAGG - Intronic
1021654253 7:22859341-22859363 TTTGGTAGTGGGGGAGTGGCAGG - Intergenic
1023976649 7:45035398-45035420 TCCGGTGGTAGGGGAGAGCATGG - Intronic
1024094533 7:45973394-45973416 TCTGGGGGTGGGGGAGCCCCAGG - Intergenic
1026321060 7:69267922-69267944 TTTTTTGGTAGGGGGGCGGCGGG + Intergenic
1026580573 7:71613000-71613022 TCTGGTGATAGGCGAGAGGGGGG - Intronic
1029537844 7:101166445-101166467 CCTTGGGGGAGGGGAGCGGCAGG - Intergenic
1029571565 7:101373118-101373140 TTTGCTGGTCGGGGAGAGGCTGG + Intronic
1033078027 7:138267849-138267871 TCTGGTGGTAGAGCTGGGGCTGG - Intergenic
1034419570 7:150982059-150982081 TGTGGTGGCAGTGGAGCAGCAGG + Intergenic
1034431953 7:151045546-151045568 TCTGGTGGGAGGGAGGCAGCCGG - Exonic
1034438241 7:151073947-151073969 TCGGGTGGAAGGGGTGGGGCAGG - Intronic
1034597750 7:152214796-152214818 TCTGGAGGTAGGGGATGGGTGGG + Intronic
1034780700 7:153879257-153879279 GTTGGTGGTAGGGAAGCTGCAGG + Intergenic
1035006839 7:155669827-155669849 TCAGGTGAGAGGGGAGGGGCCGG + Intronic
1035557582 8:578404-578426 TTTGGTGGGAGGGCAGGGGCGGG - Intergenic
1035605320 8:926577-926599 CCTGCTGGGAGGAGAGCGGCAGG + Intergenic
1036685713 8:10908645-10908667 TGTGGTGGTCGGGGAGGGCCTGG - Intronic
1039992708 8:42503341-42503363 TTTGGTGGTAGAGGAGGGACAGG + Intronic
1040389297 8:46935854-46935876 TCTGCTTGGAGGTGAGCGGCAGG - Intergenic
1049363437 8:142225143-142225165 TCTGGGGGGAGGGGGGAGGCAGG - Intronic
1049423481 8:142526965-142526987 CCTTGTGGTAGGGGAGTGGGGGG - Intronic
1049594543 8:143477399-143477421 GCTGGGGGTTGGGGAGCAGCTGG - Intronic
1055263387 9:74466346-74466368 TCTGGTTCTAGGGGAGTGGAAGG + Intergenic
1055761656 9:79615184-79615206 TCTGGAGGGAGGGGAGGAGCAGG + Intronic
1056735467 9:89205957-89205979 ACAGGTGGGAGGGGAGTGGCTGG - Intergenic
1059407974 9:114113654-114113676 TCTGGTGTTGGGGGAGGGGGTGG - Intergenic
1060727276 9:126014958-126014980 CCAGGTGGTGGGGGAGGGGCTGG - Intergenic
1060742804 9:126110698-126110720 TTTGGGGATAGAGGAGCGGCAGG + Intergenic
1061476584 9:130871483-130871505 TTTGTTGGTAGGGGAGCTGCTGG + Intronic
1062107246 9:134762429-134762451 CCTGGAGGTAGGGGAGCGAGTGG + Intronic
1062170936 9:135134271-135134293 ACTGGTGGTAGGGAAGCAGAGGG + Intergenic
1062519504 9:136951831-136951853 GGTGGGGGTAGGGGGGCGGCTGG + Intronic
1062567798 9:137170979-137171001 TCAGGTGGTAGGGGCGGGGGTGG + Exonic
1062737858 9:138148161-138148183 TCTGGAGGTTGGGGACTGGCAGG + Intergenic
1189113550 X:38320259-38320281 AGTGGTGGTGGGGGAGGGGCGGG + Intronic
1189137409 X:38562927-38562949 TATGGTGGTGGGTGAGGGGCGGG - Intronic
1189211860 X:39290524-39290546 TTTGGTGGTGGGGGAGGGGGAGG - Intergenic
1189558115 X:42166046-42166068 TGTGCTGGTAGGGGTGGGGCTGG + Intergenic
1190718649 X:53127886-53127908 GGTGGTGGTAGGGGGGCTGCAGG + Intergenic
1191086111 X:56569031-56569053 TCGTGTGGGAGGGGAGGGGCAGG + Intergenic
1192483331 X:71503800-71503822 TCTGGTGGTAGTGGAGGAGGAGG - Intronic
1193659957 X:84245528-84245550 TCTGGCGGTGGGGGGGCGGGGGG - Intergenic
1195847416 X:109243139-109243161 TCTGTTGGGAGGTGAGGGGCTGG - Intergenic
1197997902 X:132399725-132399747 TCAGGTGGTAGGGCAGCCACAGG + Intronic
1198715904 X:139557956-139557978 CCAGGTGGTAGGGGAGTGGGAGG - Intronic
1199616081 X:149657289-149657311 TCTAGCGGGAGGGGAGGGGCAGG - Intergenic
1199626559 X:149745959-149745981 TCTAGCGGGAGGGGAGGGGCAGG + Intergenic
1200181179 X:154151547-154151569 GCAGGTGGTGGAGGAGCGGCTGG + Intronic
1200186824 X:154188661-154188683 GCAGGTGGTGGAGGAGCGGCTGG + Intergenic
1200192475 X:154225799-154225821 GCAGGTGGTGGAGGAGCGGCTGG + Intronic
1200198230 X:154263603-154263625 GCAGGTGGTGGAGGAGCGGCTGG + Intronic
1202301227 Y:23416691-23416713 TGTGATGGTAGGGGATCGGGGGG + Intergenic
1202569584 Y:26253907-26253929 TGTGATGGTAGGGGATCGGGGGG - Intergenic