ID: 1008379295

View in Genome Browser
Species Human (GRCh38)
Location 6:50823764-50823786
Sequence GCCGAATGCAGCAGCACGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008379295_1008379297 -9 Left 1008379295 6:50823764-50823786 CCGGACGTGCTGCTGCATTCGGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1008379297 6:50823778-50823800 GCATTCGGCGCACCACGGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1008379295_1008379304 25 Left 1008379295 6:50823764-50823786 CCGGACGTGCTGCTGCATTCGGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1008379304 6:50823812-50823834 GGTGACAGCCTCTCGCTGCACGG 0: 1
1: 0
2: 2
3: 13
4: 140
1008379295_1008379298 -3 Left 1008379295 6:50823764-50823786 CCGGACGTGCTGCTGCATTCGGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1008379298 6:50823784-50823806 GGCGCACCACGGCCTGGACGCGG 0: 1
1: 0
2: 0
3: 8
4: 86
1008379295_1008379302 4 Left 1008379295 6:50823764-50823786 CCGGACGTGCTGCTGCATTCGGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1008379302 6:50823791-50823813 CACGGCCTGGACGCGGGCATGGG 0: 1
1: 0
2: 0
3: 6
4: 64
1008379295_1008379299 -2 Left 1008379295 6:50823764-50823786 CCGGACGTGCTGCTGCATTCGGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1008379299 6:50823785-50823807 GCGCACCACGGCCTGGACGCGGG 0: 1
1: 0
2: 0
3: 7
4: 72
1008379295_1008379301 3 Left 1008379295 6:50823764-50823786 CCGGACGTGCTGCTGCATTCGGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1008379301 6:50823790-50823812 CCACGGCCTGGACGCGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008379295 Original CRISPR GCCGAATGCAGCAGCACGTC CGG (reversed) Exonic
917626869 1:176854952-176854974 CCCGGATGCAGCAGCAAGGCTGG + Intergenic
917969917 1:180199849-180199871 GCCGCATGGAGCAGCCCCTCAGG - Exonic
1062820800 10:533188-533210 GTCAAATGCAGCAGCATCTCCGG + Intronic
1063115145 10:3067564-3067586 GCCGAGGGGAGCCGCACGTCCGG - Exonic
1066155205 10:32668746-32668768 ACCGATTCCAGCAGCACATCAGG - Intronic
1066338111 10:34501325-34501347 GACGAAAGCAGGAGCAAGTCGGG - Intronic
1076109726 10:127851308-127851330 GCTGAAAGCAGGAGCACATCGGG + Intergenic
1086243931 11:84728465-84728487 ACCAAATCCAGCAGCACATCAGG - Intronic
1089395456 11:118133820-118133842 ACGGAATGCAGGAGCACGGCTGG + Exonic
1090624211 11:128591846-128591868 GACTAATGGAGCAGCACATCAGG - Intergenic
1117014129 14:51501165-51501187 CCCAAATGAAGCAGCAAGTCAGG - Intronic
1126419089 15:48452621-48452643 GCCGAATGCATCAACACTGCAGG - Exonic
1129612240 15:77070529-77070551 GCAGACTGTAGCAGGACGTCGGG - Intronic
1131634162 15:94212441-94212463 GCTGAATCCAGCAGCACTGCCGG + Intergenic
1133207001 16:4239904-4239926 CCTGAGTGCAGCAGCAGGTCGGG + Intronic
1137669458 16:50270987-50271009 TCCGTGTGCAGCAGCAGGTCAGG - Intronic
1139588553 16:67919948-67919970 GCTGAATGCAGCAGCGTGGCGGG - Intronic
1141893961 16:86946766-86946788 GCTGAAGGCAGCAGCCTGTCTGG - Intergenic
1147028408 17:37609362-37609384 GGCGAAGGCAGCGGCAGGTCGGG - Exonic
1151715823 17:75830572-75830594 GCCGAATCCAGCAGCAGGTGAGG - Exonic
1154366794 18:13717742-13717764 GCCCAATGCACCAGAATGTCAGG + Intronic
1165161602 19:33820044-33820066 GCCGATTGCACCAGCAGGGCCGG + Intergenic
925349435 2:3190497-3190519 CCTGAATGCAGCAGGACATCAGG + Intronic
925404608 2:3597848-3597870 GCCCAGTGGACCAGCACGTCTGG + Intronic
929669111 2:43855037-43855059 GCCGAAAGCAGGAGAATGTCTGG - Intronic
932851053 2:75187278-75187300 GCAGAGTGCAGTAGCACCTCAGG + Intronic
942087210 2:172454669-172454691 ACCTAATGTAGCAGCAGGTCTGG - Intronic
946402942 2:219477989-219478011 GCCAAAGGCATCAGCGCGTCGGG + Exonic
1185377211 22:50488095-50488117 GCAGAATGCAGCAGCCTGTAGGG + Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
966861486 3:184233297-184233319 GCCACATGCAGCACCCCGTCAGG - Exonic
968481862 4:836838-836860 CCCGAGTGCAGCACCACTTCTGG - Intergenic
970796358 4:19918047-19918069 ACCAAATCCAGCAGCACATCAGG - Intergenic
976210033 4:82658709-82658731 ACCAAATCCAGCAGCACATCAGG - Intronic
978117000 4:105031424-105031446 CCCAAATCCAGCAGCACATCAGG + Intergenic
989981741 5:50654077-50654099 CATGAATGCAGCAGCACGTGAGG - Intergenic
1008379295 6:50823764-50823786 GCCGAATGCAGCAGCACGTCCGG - Exonic
1023731470 7:43195981-43196003 GCCAAATCCAGCACCACGTTGGG + Intronic
1032692435 7:134302385-134302407 GCAGAATGCAACATCACATCTGG - Intronic
1035251014 7:157596959-157596981 CCCAAATGCAGCAGCACTTAAGG - Intronic
1040349383 8:46549019-46549041 GTTGAATGCAGCAGCAGTTCTGG + Intergenic
1040369152 8:46751099-46751121 GTTGAATGCAGCAGCAGTTCTGG - Intergenic
1041437208 8:57855412-57855434 GCAGGATGCAGATGCACGTCAGG - Intergenic
1041907411 8:63049036-63049058 ACCAAATCCAGCAGCACATCAGG + Intronic
1049080482 8:140439152-140439174 GCCGCATGCGGAAGCACGTGGGG - Exonic
1049141009 8:140954120-140954142 GCTGGATGCAACATCACGTCTGG + Intronic
1049735329 8:144202159-144202181 GCCCAAAGCAGCAGGACTTCAGG - Intronic
1050388155 9:5111683-5111705 GGCGGAGGCAGCAGCACGTTTGG + Intronic
1050972410 9:11894222-11894244 ACCAAATCCAGCAGCACGTCAGG - Intergenic
1051678207 9:19580039-19580061 TCCCACTGCAGCAGCACCTCAGG + Intronic
1057221887 9:93261910-93261932 GCGGCAGGCAGCAGCACTTCCGG - Exonic
1189405289 X:40716848-40716870 GCCGTTTGCAACAGCACGTATGG + Intronic
1189743588 X:44146657-44146679 GCAGAATGCATCAGCATTTCAGG + Intergenic
1189859512 X:45258474-45258496 GCAGAATGCAGCAGCAATCCTGG + Intergenic
1198925535 X:141787978-141788000 CCGCAATGCAGCAGAACGTCAGG - Intergenic