ID: 1008380481

View in Genome Browser
Species Human (GRCh38)
Location 6:50835290-50835312
Sequence TGTTCCAAACAATCACTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008380480_1008380481 -5 Left 1008380480 6:50835272-50835294 CCTGTTGTAAATCATAACTGTTC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1008380481 6:50835290-50835312 TGTTCCAAACAATCACTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008380481 Original CRISPR TGTTCCAAACAATCACTAGC CGG Intronic
No off target data available for this crispr