ID: 1008382032

View in Genome Browser
Species Human (GRCh38)
Location 6:50846823-50846845
Sequence CTATGGGTGTGGAGGCCAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008382032_1008382044 26 Left 1008382032 6:50846823-50846845 CCTTCTGGCCTCCACACCCATAG 0: 1
1: 0
2: 1
3: 27
4: 294
Right 1008382044 6:50846872-50846894 CGAAGAGGCTTTTAAAGACCTGG 0: 1
1: 0
2: 1
3: 11
4: 87
1008382032_1008382040 11 Left 1008382032 6:50846823-50846845 CCTTCTGGCCTCCACACCCATAG 0: 1
1: 0
2: 1
3: 27
4: 294
Right 1008382040 6:50846857-50846879 CCCCACTTAAAGAACCGAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008382032 Original CRISPR CTATGGGTGTGGAGGCCAGA AGG (reversed) Exonic
900520801 1:3104687-3104709 CTAGGGGTTTGTAGCCCAGAGGG - Intronic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900638394 1:3676532-3676554 CTATGGAAGACGAGGCCAGAGGG + Intronic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
903578552 1:24354129-24354151 CTGTGAGTGTGGGGGCCAGCAGG + Intronic
906025275 1:42668312-42668334 AAATGGGTGAGGAGGCAAGAAGG - Intronic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
907657820 1:56362318-56362340 TTAGGGAGGTGGAGGCCAGATGG - Intergenic
908329727 1:63059273-63059295 GCATGAGTTTGGAGGCCAGATGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
919754085 1:201055820-201055842 CTTTGGTGGTGGAGGCCAGGAGG - Intronic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1064137537 10:12763940-12763962 CTGTGGGGGTGGGGGCCACAGGG - Intronic
1065819406 10:29511238-29511260 CCTTAGGTGTGGAAGCCAGAAGG - Intronic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1065953441 10:30673176-30673198 CCTTAGGTGTGGAAGCCAGAAGG + Intergenic
1066062851 10:31739480-31739502 CTATGGGTCTGGAGGCAATGAGG - Intergenic
1066681086 10:37937516-37937538 CTATAGGTGGAGAGGCCACAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067432743 10:46254588-46254610 CTATAGGTTAGGAGGCCAGGGGG - Intergenic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG + Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1072944877 10:99800745-99800767 CAATGGGTGGAGAGGCCAGGAGG + Intronic
1074140529 10:110668241-110668263 CCTTGGGTGGGGAGGCCAAAAGG + Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1077501199 11:2910502-2910524 CCCTGGGTGTGGAAGCCAGGGGG + Intronic
1078308335 11:10213638-10213660 CTATTGGTCTAGAGGCCAAAAGG + Intronic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1079349647 11:19681624-19681646 CTATTGGTGTGGAGGACCAAGGG - Intronic
1080101520 11:28465454-28465476 TTATAGGTGTGGAAGTCAGAAGG - Intergenic
1080447296 11:32349285-32349307 CTATAGGTTTGGAGGCCAATTGG - Intergenic
1081657726 11:44868448-44868470 GTATGGGTGTGGAGGGCACCTGG + Intronic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1081808289 11:45901676-45901698 CAATGTGTGTGGTGGCAAGAGGG - Intronic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1085409374 11:76282278-76282300 CGATGGGAGTGGAGGCTGGATGG + Intergenic
1086605905 11:88696107-88696129 AGATGGATGGGGAGGCCAGAAGG + Intronic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090814304 11:130277941-130277963 TTATAGCAGTGGAGGCCAGAAGG - Intronic
1091293443 11:134455469-134455491 CTATGGGAGTGCAGCCCAGCAGG - Intergenic
1092033293 12:5308075-5308097 CAATGGGTGTGGAGGCTTGGAGG - Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092358118 12:7813910-7813932 ATATGAGTGTGGAAGCCGGAGGG - Intronic
1092371564 12:7921008-7921030 ATATGAGTGTGGAAGCCGGAGGG - Exonic
1096518358 12:52170618-52170640 CCCTGGGAGTGGAAGCCAGATGG - Exonic
1097636194 12:62125232-62125254 CTAAGGGTGAGGACTCCAGAGGG - Intronic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1103180933 12:118910740-118910762 CTATGTGGATGGAAGCCAGATGG + Intergenic
1103860656 12:124010575-124010597 ATATGTGTGTGGGTGCCAGAGGG + Intronic
1104159159 12:126161938-126161960 ATATGTGAGTGGAGCCCAGAGGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1106057156 13:26249135-26249157 GTATAGGAGAGGAGGCCAGAGGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1107616251 13:42171357-42171379 CTTTATGTGTGTAGGCCAGATGG + Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1109336643 13:61003252-61003274 CTATGGTAGTGGTGGCCACAAGG - Intergenic
1115884536 14:37956441-37956463 CTATGGGGGAGGAGCCAAGACGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117561445 14:56943578-56943600 CTTTGAATGTGGATGCCAGAGGG - Intergenic
1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG + Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118594009 14:67422124-67422146 CCCTGGGTGTATAGGCCAGATGG - Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120972855 14:90222979-90223001 CAATGGCTGGGGAGGCCTGAGGG + Intergenic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1122302552 14:100739210-100739232 CCTTGGGTGGGGAGACCAGAGGG - Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1123100761 14:105797913-105797935 ACATGGGTGTGGAGGCCTGCAGG - Intergenic
1124497844 15:30197269-30197291 CTATGAGTGTGAAAACCAGAGGG - Intergenic
1124745739 15:32341406-32341428 CTATGAGTGTGAAAACCAGAGGG + Intergenic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128748562 15:70132267-70132289 GTATTGGTGTGGAAGCCAGCTGG + Intergenic
1129530097 15:76258668-76258690 CCATGGGTGTGGATGGCAGTGGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130760844 15:86818166-86818188 TTATAGCTCTGGAGGCCAGAAGG - Intronic
1132358192 15:101189252-101189274 GCACGGGCGTGGAGGCCAGAGGG - Intronic
1133026000 16:2989242-2989264 CTAGGGCAGTGGAGGCTAGAGGG - Intergenic
1133788297 16:8989762-8989784 ATCTGGGTGTGGCAGCCAGAGGG - Intergenic
1134345660 16:13388988-13389010 CTATGCGTGTATAGGACAGAGGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1137663612 16:50233471-50233493 CTAAGGGTGTGAAGTCAAGATGG - Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1144519216 17:15943292-15943314 TTATGCCTGTGGAGGGCAGAGGG + Intergenic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG + Intergenic
1146617718 17:34370131-34370153 CTACGGGAGTGGGGGCCAGGAGG - Intergenic
1146951581 17:36910309-36910331 CCATGGGTGAGGAGGCTAAAGGG - Intergenic
1147978124 17:44259455-44259477 CGAGGGGTGTGGAGGGCTGAGGG + Intronic
1148031241 17:44622636-44622658 CTATGGGTGTGAGGGCCTGTGGG - Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1150259298 17:63774998-63775020 CTATAGGAGTGGGGGCAAGAGGG - Intronic
1150299078 17:64033649-64033671 CTATGGTGATGGAAGCCAGAGGG + Intergenic
1150805576 17:68316210-68316232 GTATTTGAGTGGAGGCCAGAAGG - Intronic
1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG + Intronic
1151724761 17:75877595-75877617 CTATGGGGGTGTAGGCGGGAGGG - Intronic
1152278808 17:79373223-79373245 GTAGGGGTGGGGAGGACAGAGGG - Intronic
1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG + Intergenic
1153809662 18:8740863-8740885 CTATGGCTGTGGATTCCACAAGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1157801954 18:50628010-50628032 CAATGGGTGTGGTGGCCTGGTGG - Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160414127 18:78696026-78696048 ATATGGCTGTGGAGGCCTCACGG + Intergenic
1160825373 19:1077834-1077856 CTGTGGGTGTGGGAGCCAGGAGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161387955 19:4007079-4007101 CCATGGGTGGGGAGGCAGGATGG + Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166120341 19:40682696-40682718 CTGTGGGGGTGGACGCCAGGGGG - Intronic
925160276 2:1678591-1678613 CTATGGGTGTTCATTCCAGATGG - Intronic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
926272318 2:11375978-11376000 GTATGGGTGGGGAGGCTGGAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
928121391 2:28586305-28586327 CTATAGGAGCGGAGGGCAGAGGG - Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941517309 2:166494921-166494943 GTTTGGGAGTGAAGGCCAGAGGG + Intergenic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
943322520 2:186463103-186463125 ATAAGGGTGTGGAGGGCAGGGGG - Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
1170454160 20:16517033-16517055 GTGTGGGTGTTGTGGCCAGAGGG - Intronic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1172615575 20:36281461-36281483 CAATGGGTGTGTGGCCCAGAAGG + Intergenic
1172641650 20:36443736-36443758 CTGTCGGTGGGGAGGCCAGCTGG - Intronic
1173530880 20:43768622-43768644 CTATGGGAGGGGAGGCATGAGGG - Intergenic
1173552244 20:43940600-43940622 CTATGGGGATCCAGGCCAGAAGG + Intronic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1176372628 21:6071599-6071621 CTATGGTTGCAGAGGCCACAAGG - Intergenic
1176385786 21:6138038-6138060 CTGTGGATGCGTAGGCCAGAGGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1179326875 21:40355197-40355219 CTATGGGTGTGGAGGCAGCCAGG + Intronic
1179737687 21:43400214-43400236 CTGTGGATGCGTAGGCCAGAGGG + Intergenic
1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG + Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG + Intronic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1181462398 22:23093523-23093545 CTATGGAGGAGGAGGACAGAGGG + Intronic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1182487817 22:30649759-30649781 CTATGGCAGTGGGGGCCAGTTGG - Intronic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1183735645 22:39643439-39643461 ATATGGGGGTGCAGGCAAGAGGG - Intronic
1183827308 22:40398443-40398465 ATCTGGCTGTGGAGGCCTGAAGG - Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
950259991 3:11536653-11536675 CTATGGGTGCAGTGGCAAGAGGG - Intronic
951273398 3:20655624-20655646 CTAGGGGTGTGGAGTCTAGCAGG - Intergenic
951575304 3:24107263-24107285 CTATTTGAGTGGAGGCCTGATGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952866054 3:37855828-37855850 TTATGGGTGTTGAAGGCAGAAGG + Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
955268876 3:57476935-57476957 CTAAGGGGGTGGAGCCAAGATGG + Intronic
955334158 3:58071239-58071261 ATAGGGGTGTGTAGGCCAGGCGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957293437 3:78306693-78306715 CTCTATGTGTGGAGGCCTGATGG + Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
959807508 3:110574559-110574581 CAATGGGTGTAGGGGCCAAAGGG - Intergenic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
963043434 3:141085420-141085442 CTATGGGAATGGAAGCCACAAGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
966627683 3:182036324-182036346 ATATTGGTTTGGAGGCCACATGG - Intergenic
966744935 3:183266515-183266537 GTATGGTGGAGGAGGCCAGAGGG + Intronic
966749840 3:183311471-183311493 CTCTGTATGTGGATGCCAGACGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967182412 3:186917913-186917935 TTATGGGGGTGGAAGGCAGAAGG - Intergenic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969622810 4:8287138-8287160 GTTTGGGCGTGGAGGCCAGGGGG + Intronic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
976511281 4:85911946-85911968 CAAAAGGAGTGGAGGCCAGAAGG - Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
982955708 4:161763528-161763550 CTATGGGTGTAGGGGAGAGAAGG + Intronic
984881973 4:184417884-184417906 CAACGGCTGTGGTGGCCAGATGG + Intronic
984947733 4:184983093-184983115 CTATGGGTTTGGGGACCAGCTGG - Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989261779 5:39426381-39426403 CTAGGGGTGTGGAGGCAGGGAGG + Intronic
989656378 5:43749328-43749350 CTATGGGGGAGGAGCCAAGATGG - Intergenic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
993257871 5:85616732-85616754 CTATAGGGGTGGAGGCCTCATGG - Intergenic
998396079 5:141818937-141818959 CAATGGGATTGGAGGCCAGTGGG + Intergenic
998693027 5:144608617-144608639 CAATGTGTGTGAAGGCGAGAAGG - Intergenic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1001450111 5:171818065-171818087 TTATTGGTGTAGTGGCCAGAAGG - Intergenic
1001636164 5:173211801-173211823 CACTGGCTGTAGAGGCCAGAGGG + Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1004746196 6:18511230-18511252 AGATGGATGGGGAGGCCAGAAGG - Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1007287957 6:40761791-40761813 CTATGGGTGAACAGGACAGAGGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1011358591 6:86498237-86498259 CTATCGGTGCGGAGCCAAGATGG - Intergenic
1012446239 6:99310016-99310038 GTATGGGTGAGCGGGCCAGATGG - Intronic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1016392747 6:143591627-143591649 CTAGGGCTGTGAAGGCCAAATGG + Intronic
1018447825 6:163874477-163874499 CCATGGGTGGGGAGGCCTCAAGG + Intergenic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG + Intronic
1023287203 7:38631824-38631846 CTAGGGATGTGGAAGCCAGCTGG + Intergenic
1025845863 7:65196891-65196913 GTATGAGTTTGGTGGCCAGATGG - Intergenic
1025896088 7:65702604-65702626 GTATGAGTTTGGTGGCCAGATGG - Intergenic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1026302713 7:69111786-69111808 CTATGGCTGGGGAGGCCTCAGGG + Intergenic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1029892387 7:103944266-103944288 CTAGGCGTGTGGAGGACAGTAGG + Intronic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1033505886 7:141999420-141999442 CCATGGCTGTGGAGTCCAAAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1037123035 8:15312996-15313018 GTAAGGGAGTGGTGGCCAGAAGG - Intergenic
1037925696 8:22842636-22842658 CTATGGCTGTGCAGGCCTGTTGG - Intronic
1037974833 8:23201679-23201701 CTATGGGGGTGGAGGCACCATGG + Intronic
1039407268 8:37324084-37324106 GCATGGGTGTGGAGGCCAAGAGG + Intergenic
1039418997 8:37420122-37420144 CTAGAGGTGAGGAGGCTAGAGGG - Intergenic
1039954432 8:42196147-42196169 CTAGGGGTGGGGGGACCAGATGG + Intronic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1043252197 8:78088774-78088796 CTATGGATGTGCGGGCAAGAAGG + Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1044900340 8:96937318-96937340 CTATGGCTGAGTGGGCCAGATGG + Intronic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1047888179 8:129276576-129276598 CTATGGGAGGGGAGGCCATAAGG - Intergenic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1048434451 8:134403045-134403067 ATGTGGGTGTGGATACCAGAAGG - Intergenic
1048867233 8:138770037-138770059 GTATGGACATGGAGGCCAGAGGG + Intronic
1049382708 8:142325423-142325445 CTAGGGGTGGGGAGGCCAAGAGG + Intronic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051301362 9:15654660-15654682 CTAAGGGGGTGGAGCCAAGATGG + Intronic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG + Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1060939684 9:127536221-127536243 CCCCAGGTGTGGAGGCCAGAGGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1185544076 X:927369-927391 CGAAGGGTGTGGACTCCAGAGGG - Intergenic
1185569734 X:1124365-1124387 CCATGTGTGTGGAGGCTGGAAGG - Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1193671777 X:84396540-84396562 TTGTGGCTGTGGTGGCCAGATGG + Intronic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1199580061 X:149351850-149351872 AGATGGATGAGGAGGCCAGAAGG + Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1201645365 Y:16223985-16224007 ATATGGGGGTGGAGCCAAGATGG - Intergenic
1201657448 Y:16361337-16361359 ATATGGGGGTGGAGCCAAGATGG + Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic
1202086446 Y:21141686-21141708 CTAAGGGTTTGGAGGCAGGAGGG - Intergenic