ID: 1008382133

View in Genome Browser
Species Human (GRCh38)
Location 6:50848004-50848026
Sequence TCTAAGAAGGAGATGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008382125_1008382133 17 Left 1008382125 6:50847964-50847986 CCCTTCCCACTGCTCGTGGGTTG No data
Right 1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG No data
1008382129_1008382133 11 Left 1008382129 6:50847970-50847992 CCACTGCTCGTGGGTTGGCATTC No data
Right 1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG No data
1008382128_1008382133 12 Left 1008382128 6:50847969-50847991 CCCACTGCTCGTGGGTTGGCATT No data
Right 1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG No data
1008382126_1008382133 16 Left 1008382126 6:50847965-50847987 CCTTCCCACTGCTCGTGGGTTGG No data
Right 1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008382133 Original CRISPR TCTAAGAAGGAGATGGTGCA CGG Intergenic
No off target data available for this crispr