ID: 1008382417

View in Genome Browser
Species Human (GRCh38)
Location 6:50849964-50849986
Sequence CCCACACCCCACCCCGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008382417_1008382432 23 Left 1008382417 6:50849964-50849986 CCCACGACGGGGTGGGGTGTGGG No data
Right 1008382432 6:50850010-50850032 GTTCCTCTCCGCCGGGATCGCGG No data
1008382417_1008382427 15 Left 1008382417 6:50849964-50849986 CCCACGACGGGGTGGGGTGTGGG No data
Right 1008382427 6:50850002-50850024 CTCCTCCCGTTCCTCTCCGCCGG No data
1008382417_1008382428 16 Left 1008382417 6:50849964-50849986 CCCACGACGGGGTGGGGTGTGGG No data
Right 1008382428 6:50850003-50850025 TCCTCCCGTTCCTCTCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008382417 Original CRISPR CCCACACCCCACCCCGTCGT GGG (reversed) Intergenic
No off target data available for this crispr