ID: 1008385215

View in Genome Browser
Species Human (GRCh38)
Location 6:50881239-50881261
Sequence CTGGCCTATCTGGGGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008385206_1008385215 -9 Left 1008385206 6:50881225-50881247 CCATTATTGTGAAACTGGCCTAT No data
Right 1008385215 6:50881239-50881261 CTGGCCTATCTGGGGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008385215 Original CRISPR CTGGCCTATCTGGGGGAGGG GGG Intergenic
No off target data available for this crispr