ID: 1008391754

View in Genome Browser
Species Human (GRCh38)
Location 6:50960036-50960058
Sequence ACCTCATGGAACATAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008391754_1008391757 -9 Left 1008391754 6:50960036-50960058 CCCTGGGTTATGTTCCATGAGGT No data
Right 1008391757 6:50960050-50960072 CCATGAGGTTTTGAAGTTTCTGG No data
1008391754_1008391758 -8 Left 1008391754 6:50960036-50960058 CCCTGGGTTATGTTCCATGAGGT No data
Right 1008391758 6:50960051-50960073 CATGAGGTTTTGAAGTTTCTGGG No data
1008391754_1008391759 10 Left 1008391754 6:50960036-50960058 CCCTGGGTTATGTTCCATGAGGT No data
Right 1008391759 6:50960069-50960091 CTGGGAGACTTCAGTGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008391754 Original CRISPR ACCTCATGGAACATAACCCA GGG (reversed) Intergenic
No off target data available for this crispr